M249-5'csr-1-Pgsy-1-luciferase-Bar-3'csr-1
(Plasmid
#89693)
-
PurposeLuciferase reporter plasmid targeted at csr-1 locus
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 89693 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRS426
-
Backbone manufacturerATCC
- Backbone size w/o insert (bp) 5726
- Total vector size (bp) 10073
-
Modifications to backbone5' and 3' csr-1 UTR for targeting to csr-1 locus. Luciferase expression under the control of gsy-1 promoter for reporter assay.
-
Vector typeYeast episomal vector
-
Selectable markersURA3 ; glyphosate (BAR gene for selection: encoding bialaphos/PPT resistance)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegsy-1 promoter, luciferase
-
Alt namegsy-1, luc
-
SpeciesN. crassa
-
Insert Size (bp)6091
- Promoter gsy-1
-
Tag
/ Fusion Protein
- luciferase
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CTTTGGATAGCTCTTGCCAGC
- 3′ sequencing primer CTGTTGCCGGTCTTGCGATG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
M249-5'csr-1-Pgsy-1-luciferase-Bar-3'csr-1 was a gift from Christian Hong (Addgene plasmid # 89693 ; http://n2t.net/addgene:89693 ; RRID:Addgene_89693) -
For your References section:
Efficient gene editing in Neurospora crassa with CRISPR technology. Matsu-Ura T, Baek M, Kwon J, Hong C. Fungal Biol Biotechnol. 2015 Jul 15;2:4. doi: 10.1186/s40694-015-0015-1. eCollection 2015. 10.1186/s40694-015-0015-1 PubMed 28955455