Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

M249-5'csr-1-Pgsy-1-luciferase-Bar-3'csr-1
(Plasmid #89693)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 89693 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pRS426
  • Backbone manufacturer
    ATCC
  • Backbone size w/o insert (bp) 5726
  • Total vector size (bp) 10073
  • Modifications to backbone
    5' and 3' csr-1 UTR for targeting to csr-1 locus. Luciferase expression under the control of gsy-1 promoter for reporter assay.
  • Vector type
    Yeast episomal vector
  • Selectable markers
    URA3 ; glyphosate (BAR gene for selection: encoding bialaphos/PPT resistance)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    gsy-1 promoter, luciferase
  • Alt name
    gsy-1, luc
  • Species
    N. crassa
  • Insert Size (bp)
    6091
  • Promoter gsy-1
  • Tag / Fusion Protein
    • luciferase

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CTTTGGATAGCTCTTGCCAGC
  • 3′ sequencing primer CTGTTGCCGGTCTTGCGATG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    M249-5'csr-1-Pgsy-1-luciferase-Bar-3'csr-1 was a gift from Christian Hong (Addgene plasmid # 89693 ; http://n2t.net/addgene:89693 ; RRID:Addgene_89693)
  • For your References section:

    Efficient gene editing in Neurospora crassa with CRISPR technology. Matsu-Ura T, Baek M, Kwon J, Hong C. Fungal Biol Biotechnol. 2015 Jul 15;2:4. doi: 10.1186/s40694-015-0015-1. eCollection 2015. 10.1186/s40694-015-0015-1 PubMed 28955455