Skip to main content
Addgene

6-His-MBP-TEV-FnCpf1
(Plasmid #90094)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 90094 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET-28
  • Backbone size w/o insert (bp) 6643
  • Total vector size (bp) 10553
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    FnCpf1 (humanized)
  • Alt name
    type V CRISPR-associated protein Cpf1 (humanized)
  • Alt name
    Cpf1 (humanized)
  • Alt name
    Francisella tularensis subsp. novicida U112 Cpf1 (humanized)
  • Species
    Francisella tularensis subsp. novicida U112
  • Insert Size (bp)
    3910
  • Promoter T7
  • Tags / Fusion Proteins
    • 6xHis (N terminal on backbone)
    • MBP (N terminal on insert)
    • TEV site (N terminal on insert)
    • Nucleoplasmin NLS (C terminal on insert)
    • 3xHA (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (unknown if destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer taatacgactcactataggg�
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note: a Flag-AviTag containing fragment follows the insert (between the XhoI and HindIII sites) but this sequence is not translated.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    6-His-MBP-TEV-FnCpf1 was a gift from Feng Zhang (Addgene plasmid # 90094 ; http://n2t.net/addgene:90094 ; RRID:Addgene_90094)
  • For your References section:

    Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Zetsche B, Gootenberg JS, Abudayyeh OO, Slaymaker IM, Makarova KS, Essletzbichler P, Volz SE, Joung J, van der Oost J, Regev A, Koonin EV, Zhang F. Cell. 2015 Sep 23. pii: S0092-8674(15)01200-3. doi: 10.1016/j.cell.2015.09.038. 10.1016/j.cell.2015.09.038 PubMed 26422227