-
PurposeCRISPRi vector for Yarrowia lipolytica, repressing KU70 and KU80 for enhanced HR
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 91249 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC19
- Backbone size w/o insert (bp) 2623
- Total vector size (bp) 13331
-
Vector typeYeast Expression, CRISPR, Synthetic Biology
-
Selectable markersLEU2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructions
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameCodon optimized dCas9-Mxi1
-
SpeciesSynthetic
-
Insert Size (bp)4311
- Promoter UAS1B8-TEF(136)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BssHII (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer GTAAAACGACGGCCAGT
- 3′ sequencing primer CAGGAAACAGCTATGAC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameKU70 sgRNA expression cassette
-
SpeciesSynthetic
-
Insert Size (bp)525
- Promoter SCR1'-tRNA
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer GCATTTATCAGGGTTATTGTCTCATGAG
- 3′ sequencing primer none
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameKU80a sgRNA expression cassette
-
SpeciesSynthetic
-
Insert Size (bp)689
- Promoter SCR1'-tRNA
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer GTAAAACGACGGCCAGTG
- 3′ sequencing primer none
- (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert nameKU80b sgRNA expression cassette
-
SpeciesSynthetic
-
Insert Size (bp)656
- Promoter SCR1'-tRNA
Cloning Information for Gene/Insert 4
- Cloning method Gibson Cloning
- 5′ sequencing primer none
- 3′ sequencing primer GGAATTCGGGTACCGC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAddgene material #44380 (UAS1B8-TEF promoter) is used to express Cas9
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRISPRi_Mxi1_yl_NHEJ was a gift from Ian Wheeldon (Addgene plasmid # 91249 ; http://n2t.net/addgene:91249 ; RRID:Addgene_91249) -
For your References section:
CRISPRi repression of nonhomologous end-joining for enhanced genome engineering via homologous recombination in Yarrowia lipolytica. Schwartz C, Frogue K, Ramesh A, Misa J, Wheeldon I. Biotechnol Bioeng. 2017 Aug 19. doi: 10.1002/bit.26404. 10.1002/bit.26404 PubMed 28832943