Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

c-myc-PT3EF1a
(Plasmid #92046)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 92046 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pT3-EF1a
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    C-MYC
  • Alt name
    MYC
  • Species
    H. sapiens (human)
  • GenBank ID
    P01106.1
  • Entrez Gene
    MYC (a.k.a. MRTL, MYCC, bHLHe39, c-Myc)
  • Promoter EF-1a

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer GAGTTTGGATCTTGGTTCATTC
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid is in the OPEN state: there is no stop codon on c-myc.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    c-myc-PT3EF1a was a gift from Xin Chen (Addgene plasmid # 92046 ; http://n2t.net/addgene:92046 ; RRID:Addgene_92046)
  • For your References section:

    A functional mTORC1 signaling is indispensable for c-Myc driven hepatocarcinogenesis. Liu P, Ge M, Hu J, Li X, Che L, Sun K, Cheng L, Huang Y, Pilo MG, Cigliano A, Pes GM, Pascale RM, Brozzetti S, Vidili G, Porcu A, Cossu A, Palmieri G, Sini MC, Ribback S, Dombrowski F, Tao J, Calvisi DF, Chen L, Chen X. Hepatology. 2017 Mar 30. doi: 10.1002/hep.29183. 10.1002/hep.29183 PubMed 28370287