Skip to main content

gCOTS-pyl
(Plasmid #92048)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 92048 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAM1573
  • Backbone size w/o insert (bp) 7000
  • Total vector size (bp) 11776
  • Modifications to backbone
    In addition to E. coli origin, we have introduced the 2micron yeast origin and UTA3 marker to enable genetic engineering using yeast assembly.
  • Vector type
    Cyanobacteria S. elongatus genome recombination into neutral site 2
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Amp resistace in E. coli, inrecombination in S. elongatus use cmp as marker selection. Use final concentration of 10ug/ml cmp for selection.
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    Pyrrolysyl tRNA(cua)
  • Alt name
    Pyl-tRNA
  • Species
    Methanosarcina mazei
  • Insert Size (bp)
    72
  • Promoter LeuP (native S. elongatus promoter)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GTATTAGGCAAATGCCAGTTAC
  • 3′ sequencing primer GTAAACCGCGAAGGTCGTGAAGG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Pyrrolysyl tRNA synthetase (methanosarcina mazei)
  • Alt name
    PylRS
  • Species
    Methanosarcina mazei
  • Insert Size (bp)
    1365
  • Promoter PrcbL

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCACACCACGTAATTTG
  • 3′ sequencing primer CACAGGAAACAGCTATGACC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The depositor notes that discrepancies between the Genbank file and Addgene's QC should not have functional consequences.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    gCOTS-pyl was a gift from Lital Alfonta (Addgene plasmid # 92048 ; http://n2t.net/addgene:92048 ; RRID:Addgene_92048)
  • For your References section:

    Expanding the Genetic Code of a Photoautotrophic Organism. Chemla Y, Friedman M, Heltberg M, Bakhrat A, Nagar E, Schwarz R, Jensen MH, Alfonta L. Biochemistry. 2017 Apr 12. doi: 10.1021/acs.biochem.7b00131. 10.1021/acs.biochem.7b00131 PubMed 28394580