Skip to main content

pLenti_dCas9-2xAM_hIRF-1
(Plasmid #92221)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 92221 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    CSII-U6-gRNA-CBh-3xFLAG-PA-dCas9-P2A-Puro
  • Backbone manufacturer
    Yoichi Sekita
  • Backbone size w/o insert (bp) 9921
  • Total vector size (bp) 14156
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    Sp-dCas9-2xAM tag
  • Species
    Synthetic; S. pyogenes
  • Insert Size (bp)
    4233
  • Mutation
    human codon-optimized, D10A + H840A
  • Promoter CBh
  • Tag / Fusion Protein
    • 2xAM tag (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site Age I (not destroyed)
  • 3′ cloning site BamH I (not destroyed)
  • 5′ sequencing primer TGGCAGTATTCATCCACAATTT
  • 3′ sequencing primer CCACATAGCGTAAAAGGAGC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    gRNA targeting human IRF-1 promoter
  • Species
    Synthetic
  • Insert Size (bp)
    20
  • Promoter U6

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bbs I (destroyed during cloning)
  • 3′ cloning site Bbs I (destroyed during cloning)
  • 5′ sequencing primer gagggcctatttcccatgat
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti_dCas9-2xAM_hIRF-1 was a gift from Hodaka Fujii (Addgene plasmid # 92221 ; http://n2t.net/addgene:92221 ; RRID:Addgene_92221)
  • For your References section:

    enChIP systems using different CRISPR orthologues and epitope tags. Fujita T, Yuno M, Fujii H. BMC Res Notes. 2018 Feb 27;11(1):154. doi: 10.1186/s13104-018-3262-4. 10.1186/s13104-018-3262-4 PubMed 29482606