Skip to main content

pJB153
(Plasmid #92328)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 92328 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCA24N
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Note the depositor uses BW25113 for molecular/imaging assays, as this strain provided a more “wild-type” background.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ZapA
  • Species
    E. coli
  • Insert Size (bp)
    327
  • Promoter T5-lac
  • Tag / Fusion Protein
    • mEos3.2 (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer ctttcgtcttcacctcgagaaatc
  • 3′ sequencing primer gctaattaagcttggctgcaggt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJB153 was a gift from Jie Xiao (Addgene plasmid # 92328 ; http://n2t.net/addgene:92328 ; RRID:Addgene_92328)
  • For your References section:

    Influence of FtsZ GTPase activity and concentration on nanoscale Z-ring structure in vivo revealed by three-dimensional Superresolution imaging. Lyu Z, Coltharp C, Yang X, Xiao J. Biopolymers. 2016 Oct;105(10):725-34. doi: 10.1002/bip.22895. 10.1002/bip.22895 PubMed 27310678