pKL002
(Plasmid
#98921)
-
PurposepET DUET backbone with PROPS voltage indicator and GCaMP6f calcium sensor in the two MCS.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 98921 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepETDuet-1
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5100
- Total vector size (bp) 7451
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsorigin is ColE1 - Incompatibility group A; Depositor recommends BL21 for expression
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namePROPS
-
Alt nameProteorhodopsin Optical Proton Sensor
-
Alt namevoltage sensor
-
SpeciesSynthetic
-
Insert Size (bp)747
- Promoter T7
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGCGTCCGGCGTAGA
- 3′ sequencing primer GATTATGCGGCCGTGTACAA
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameGCaMP6f
-
SpeciesSynthetic
-
Insert Size (bp)1326
- Promoter T7
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer TTGTACACGGCCGCATAATC
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKL002 was a gift from Joel Kralj (Addgene plasmid # 98921 ; http://n2t.net/addgene:98921 ; RRID:Addgene_98921) -
For your References section:
Voltage-gated calcium flux mediates Escherichia coli mechanosensation. Bruni GN, Weekley RA, Dodd BJT, Kralj JM. Proc Natl Acad Sci U S A. 2017 Aug 29;114(35):9445-9450. doi: 10.1073/pnas.1703084114. Epub 2017 Aug 14. 10.1073/pnas.1703084114 PubMed 28808010