Icam 2 SaCas9 YAP sgRNA2
(Plasmid
#99735)
-
PurposeExpresses SaCas9 and a gRNA targeting mouse YAP
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 99735 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA (Addgene Plasmid #61591)
-
Backbone manufacturerFeng Zhang Lab
-
Vector typeMammalian Expression, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSaCas9 gRNA targeting Yap1
-
Alt nameSaCas9 gRNA targeting yes-associated protein 1
-
gRNA/shRNA sequenceTGCACGACCTGGTGGCCGGCC
-
SpeciesM. musculus (mouse)
-
Entrez GeneYap1 (a.k.a. Yap, Yap65, Yki, Yorkie)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer LKO.1 5' (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Icam 2 SaCas9 YAP sgRNA2 was a gift from Yu Huang (Addgene plasmid # 99735 ; http://n2t.net/addgene:99735 ; RRID:Addgene_99735) -
For your References section:
Integrin-YAP/TAZ-JNK cascade mediates atheroprotective effect of unidirectional shear flow. Wang L, Luo JY, Li B, Tian XY, Chen LJ, Huang Y, Liu J, Deng D, Lau CW, Wan S, Ai D, Mak KK, Tong KK, Kwan KM, Wang N, Chiu JJ, Zhu Y, Huang Y. Nature. 2016 Dec 7. doi: 10.1038/nature20602. 10.1038/nature20602 PubMed 27926730