Skip to main content

pLEM415-ldhL-mRFP1
(Plasmid #99842)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 99842 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLEM415
  • Backbone manufacturer
    Michel Fons
  • Backbone size w/o insert (bp) 6332
  • Total vector size (bp) 7357
  • Modifications to backbone
    the ldhl promoter was inserted 5’ of the FLAG-mRFP1
  • Vector type
    Bacterial Expression
  • Selectable markers
    Erythromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    LB medium
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    monomeric red fluorescent protein
  • Alt name
    mRFP1
  • Species
    Discosoma coral
  • Insert Size (bp)
    1025
  • GenBank ID
    AF506025
  • Promoter ldhl
  • Tag / Fusion Protein
    • FLAG/Xpress (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site ApaI (not destroyed)
  • 3′ cloning site ClaI (not destroyed)
  • 5′ sequencing primer GCAAGGCGATTAAGTTGGGTAAC
  • 3′ sequencing primer ACGGTAAAACCATCGACCAATATCT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Dr. Roger Y. Tsien, UC San Diego
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Campbell RE, Tour O, Palmer AE, Steinbach PA, Baird GS, et al. (2002) A monomeric red fluorescent protein. Proc Natl Acad Sci U S A 99: 7877-7882.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLEM415-ldhL-mRFP1 was a gift from Sujin Bao (Addgene plasmid # 99842 ; http://n2t.net/addgene:99842 ; RRID:Addgene_99842)
  • For your References section:

    Distribution dynamics of recombinant Lactobacillus in the gastrointestinal tract of neonatal rats. Bao S, Zhu L, Zhuang Q, Wang L, Xu PX, Itoh K, Holzman IR, Lin J. PLoS One. 2013;8(3):e60007. doi: 10.1371/journal.pone.0060007. Epub 2013 Mar 27. PONE-D-12-29032 [pii] PubMed 23544119