Skip to main content

Recently Deposited Plasmids


ID Plasmid Gene/Insert PI Available On
187252 pLL5.0-EGFP-HRasC20 HRasC20 (Homo sapiens) Yap Sep 22, 2022
188151 Anti-Fig4/Sac3 [N202/7R] anti-Fig4/Sac3 (Mus musculus) recombinant mouse monoclonal antibody (Mus musculus) Trimmer Sep 22, 2022
188225 Anti-KChIP1 K+ channel [K55/7R] anti-KChIP1 K+ channel (Rattus norvegicus) recombinant mouse monoclonal antibody (Mus musculus) Trimmer Sep 22, 2022
173157 pJET1.2-U6 sgRNA cassette under U6 promoter (Arabidopsis thaliana) Ziolkowski Sep 22, 2022
188722 p2151 pHAGE-hSPC-TFEB-TagBFP-W TFEB (Homo sapiens) Kotton Sep 22, 2022
184934 pSF11-wmTagBFP2 mTagBFP2 (Caenorhabditis elegans) Piatkevich Sep 22, 2022
182127 3xNLS-NLP-cMyc-cMyc enAspCas12a 3xNLS-NLP-cMyc-cMyc enAspCas12a (Other) Wolfe Sep 22, 2022
182120 2xNLS-NLP-cMyc AspCas12a 2xNLS-NLP-cMyc AspCas12a (Other) Wolfe Sep 22, 2022
182126 1N/2CxNLS-cMyc-NLP-cMyc enAspCas12a 1N/2CxNLS-cMyc-NLP-cMyc AspCas12aen (Other) Wolfe Sep 22, 2022
182122 3xNLS-NLP-cMyc-cMyc AspCas12a 3xNLS-NLP-cMyc-cMyc AspCas12a (Other) Wolfe Sep 22, 2022
182121 1N/2CxNLS-cMyc-NLP-cMyc AspCas12a 1N/2CxNLS-cMyc-NLP-cMyc AspCas12a (Other) Wolfe Sep 22, 2022
182124 1N/2CxNLS-cMyc-NLP-cMyc LbaCas12a 1N/2CxNLS-cMyc-NLP-cMyc LbaCas12a (Other) Wolfe Sep 22, 2022
188969 pA-RFP-rG2 mCherry (Synthetic), sgRNA: agtccatgtaatcagcgtctactagt Lee Sep 22, 2022
188902 pHR-UCOE-SFFV-dCas9-KRAB(Kox1)-MeCP2-P2A-EGFP dCas9-KRAB(Kox1)-MeCP2 (Other) Weissman Sep 22, 2022
182123 2xNLS-NLP-cMyc LbaCas12a 2xNLS-NLP-cMyc LbaCas12a (Other) Wolfe Sep 22, 2022
190076 AttB_ACE2_IRES_iRFP670-H2A-P2A-PuroR ACE2 (Homo sapiens) Matreyek Sep 22, 2022
189936 pET28a-SUMO-MjDim1 rsmA (Other) He Sep 22, 2022
184620 pCIS.MTRIA-UTS MTRIA-UTS (Synthetic) Ino Sep 22, 2022
184616 pCIS.MTRIA-PAF MTRIA-PAF (Synthetic) Ino Sep 22, 2022
184607 pCIS.MTRIA-MTN MTRIA-MTN (Synthetic) Ino Sep 22, 2022
184599 pCIS.MTRIA-ATP MTRIA-ATP (Synthetic) Ino Sep 22, 2022
134299 pFudioFRTPSD-95TealW PSD-95-Teal (Mus musculus) Nedivi Sep 22, 2022
184644 pLPC-Flag-BirA-Linker-Myc-mRap1 BirA-rap1 (Mus musculus) Sfeir Sep 21, 2022
182934 pIN3_enpp-1_mScarlet genomic enpp-1 fused to mScarlet (Caenorhabditis elegans) Barr Sep 21, 2022
188450 pTZ tRNA_gRNA empty scaffold Chande Sep 21, 2022
190479 pSPL3-hRPH3A_c.1853Gmut RPH3A (NM_014954.3) c.1853 [exon 20 and part of surrounding introns only] (Homo sapiens) Brusco Sep 21, 2022
190476 pSPL3-hRPH3A_c.444Gwt RPH3A (NM_014954.3) c.444 [exon 7 and part of surrounding introns only] (Homo sapiens) Brusco Sep 21, 2022
188541 pSPCas9(BB)-2A-GFP_ABCA3GFP_targeting gRNA (Homo sapiens) Kotton Sep 21, 2022
187279 GFP-Rock1-GBD (840-110 aa) in pEGFPN1 Rock1 (Mus musculus) Yap Sep 21, 2022
187280 GFP-mDia1-GBD (1-305 aa) in pEGFPN1 mDia1 (Mus musculus) Yap Sep 21, 2022
187284 IL2-mCherry-AH in pmCherryN1 interleukin-2 receptor alpha-subunit, anillin (Homo sapiens) Yap Sep 21, 2022
187773 MAC_C_LMTK3 LMTK3 (Homo sapiens) Varjosalo Sep 21, 2022
187763 MAC_C_EPHB6 EPHB6 (Homo sapiens) Varjosalo Sep 21, 2022
187762 MAC_C_LTK LTK (Homo sapiens) Varjosalo Sep 21, 2022
187788 MAC_C_INSR INSR (Homo sapiens) Varjosalo Sep 21, 2022
187797 MAC_C_EPHB2 EPHB2 (Homo sapiens) Varjosalo Sep 21, 2022
187801 DUX4 pDonor221 DUX4 (Homo sapiens) Varjosalo Sep 21, 2022
187802 DUX4_KBM pDonor221 DUX4-KBM (Homo sapiens) Varjosalo Sep 21, 2022
187770 MAC_C_IGF1R IGF1R (Homo sapiens) Varjosalo Sep 21, 2022
185779 PGK-IKZF3-CTERM-GFP GFP (Other) Sellers Sep 21, 2022
185778 PGK-AID-CTERM-GFP GFP (Other) Sellers Sep 21, 2022
185777 PGK-HALO-CTERM-GFP GFP (Other) Sellers Sep 21, 2022
185776 PGK-SMASH-CTERM-GFP GFP (Other) Sellers Sep 21, 2022
185774 PGK-IKZF3-NTERM-GFP GFP (Other) Sellers Sep 21, 2022
185773 PGK-AID-NTERM-GFP GFP (Other) Sellers Sep 21, 2022
185772 PGK-HALO-NTERM-GFP GFP (Other) Sellers Sep 21, 2022
185771 PGK-SMASH-NTERM-GFP GFP (Other) Sellers Sep 21, 2022
185769 SFFV-IKZF3-CTERM-GFP GFP (Other) Sellers Sep 21, 2022
185768 SFFV-AID-CTERM-GFP GFP (Other) Sellers Sep 21, 2022
185767 SFFV-HALO-CTERM-GFP GFP (Other) Sellers Sep 21, 2022