Skip to main content

Recently Deposited Plasmids


ID Plasmid Gene/Insert PI Available On
108455 iTol2Amp-γ-crystallin:RFP Tol2-Amp-y-cryst-mCherry Mercader Huber Sep 25, 2018
111568 pZac2.1-GfaABC1D-mCherry-hPMCA2w/b Plasma membrane calcium pump 2, variant w/b (Homo sapiens) Khakh Sep 25, 2018
113978 pOGG001 nptII promoter (Synthetic) Poole Sep 24, 2018
113981 pOGG006 Level 2 golden gate cloning vector (Synthetic) Poole Sep 24, 2018
109067 p3PA-Puro-iTk Lander Sep 24, 2018
109066 pstop Lander Sep 24, 2018
114495 Anti-Foxi3 [N359/28R] anti-Foxi3 (Mus musculus) recombinant mouse monoclonal antibody (Mus musculus) Trimmer Sep 24, 2018
113758 pGEM-gate gateway cassette (Other) Bezanilla Sep 24, 2018
113757 pENTR-R4R3-3xmRuby-C mRuby2-mRuby2-mRuby2 (Other) Bezanilla Sep 24, 2018
113756 pENTR-R4R3-2xmRuby-C mRuby2-mRuby2 (Other) Bezanilla Sep 24, 2018
113755 pENTR-R4R3-mRuby-C mRuby2 (Other) Bezanilla Sep 24, 2018
113754 pENTR-R4R3-3xmRuby-N mRuby2-mRuby2-mRuby2 (Other) Bezanilla Sep 24, 2018
113753 pENTR-R4R3-2xmRuby-N mRuby2-mRuby2 (Other) Bezanilla Sep 24, 2018
113751 pENTR-R4R3-3xmEGFP-C mEGFP-mEGFP-mEGFP (Other) Bezanilla Sep 24, 2018
113750 pENTR-R4R3-2xmEGFP-C mEGFP-mEGFP (Other) Bezanilla Sep 24, 2018
113749 pENTR-R4R3-mEGFP-C mEGFP (Other) Bezanilla Sep 24, 2018
113748 pENTR-R4R3-3xmEGFP-N mEGFP-mEGFP-mEGFP (Other) Bezanilla Sep 24, 2018
113747 pENTR-R4R3-2xmEGFP-N mEGFP-mEGFP (Other) Bezanilla Sep 24, 2018
113746 pENTR-R4R3-mEGFP-N mEGFP (Other) Bezanilla Sep 24, 2018
113745 pENTR-R4R3-stop stop cassette (Synthetic) Bezanilla Sep 24, 2018
113744 pZeo-Cas9-gate Cas9 (Other) Bezanilla Sep 24, 2018
113743 pMK-Cas9-gate Cas9 (Other) Bezanilla Sep 24, 2018
113742 pMH-Cas9-gate Cas9 (Other) Bezanilla Sep 24, 2018
113741 pENTR-PpU6P-sgRNA-L5L4 PpU6P::sgRNA (Other) Bezanilla Sep 24, 2018
113740 pENTR-PpU6P-sgRNA-L3L2 PpU6P::sgRNA (Other) Bezanilla Sep 24, 2018
113739 pENTR-PpU6P-sgRNA-R4R3 PpU6P::sgRNA (Other) Bezanilla Sep 24, 2018
113738 pENTR-PpU6P-sgRNA-L5L2 PpU6P::sgRNA (Other) Bezanilla Sep 24, 2018
113737 pENTR-PpU6P-sgRNA-L1R5 PpU6P::sgRNA (Other) Bezanilla Sep 24, 2018
113736 pENTR-PpU6P-sgRNA-L1L4 PpU6P::sgRNA (Other) Bezanilla Sep 24, 2018
113735 pENTR-PpU6P-sgRNA-L1L2 PpU6P::sgRNA (Other) Bezanilla Sep 24, 2018
114000 pOGG082 NifH promoter (Synthetic) Poole Sep 24, 2018
113990 pOGG016 Endlinker/terminator Part 6 (Synthetic) Poole Sep 24, 2018
61479 pEn-C1.1 AtU6-26:sgRNA (Arabidopsis thaliana) Puchta Sep 24, 2018
61478 pCAS9-TPC Cas9 (Arabidopsis thaliana) Puchta Sep 24, 2018
61477 pDe-CAS9-D10A Cas9-D10A (Arabidopsis thaliana) Puchta Sep 24, 2018
61476 pChimera U6-26:sgRNA (Arabidopsis thaliana) Puchta Sep 24, 2018
61433 pDe-CAS9 Cas9 (Arabidopsis thaliana) Puchta Sep 24, 2018
61432 pEn-Chimera AtU6-26:sgRNA (Arabidopsis thaliana) Puchta Sep 24, 2018
115651 pJH298 V(D)J recombination substrate Gellert Sep 24, 2018
115503 pOGG202 pL1M-F1-plac pOGG031, sfGFP pOGG037, T-pharma pOGG003 (Synthetic) Poole Sep 24, 2018
115650 Rag2 T490A Rag2 (Mus musculus) Gellert Sep 24, 2018
115649 R2Ct (1-520) Rag2 (1-520) (Mus musculus) Gellert Sep 24, 2018
115504 pOGG203 pL1M-F2-pNeo pOGG001, mCherry EC15071, T-pharma(pOGG003 (Synthetic) Poole Sep 24, 2018
115646 coreR1 (384-1008) Rag1 core (384-1008) (Mus musculus) Gellert Sep 24, 2018
112008 pAAV-hSynapsin1-FLEx-axon-GCaMP6s-P2A-mRuby3 axon-GCaMP6s-P2A-mRuby3 (Synthetic) Tian Sep 24, 2018
99695 pAAV-CMV-dSa VP64 Neurog2 dCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Mus musculus) Church Sep 22, 2018
80591 TR-GFP GFP Asokan Sep 22, 2018
115365 phRL TK 5BoxB sp 36 Renilla Luciferase (Other) Filipowicz Sep 21, 2018
115360 pCIneo-HA HA (Other) Filipowicz Sep 21, 2018
115359 pCIneo-NHA N peptide and HA (Other) Filipowicz Sep 21, 2018