We narrowed to 12,330 results for: nls
-
Plasmid#104054PurposeAn AAV genome encoding expression of the nuclear localized fluorescent protein tdTomato from the MBP promoterDepositorInsert2xNLS-tdTomato
UseAAVTagsNLSPromoterMBPAvailable SinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV-EFS_mCherry2-NLS-PEST_Puro
Plasmid#213775PurposeFluorescent reporter designed on shortlist of Housekeeping-like signature and transcription factor genes from Tabula Sapiens and Tabula Muris databases.DepositorInsertEFS_mCherry2-NLS-PEST
UseLentiviral and Synthetic BiologyAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
TRE-mClover3-TDP-43ΔNLS
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mDlx-NLS-mRuby2
Plasmid#99130PurposeAn AAV genome that expresses nuclear localized mRuby2 from the mouse Dlx5/6 enhancerDepositorHas ServiceAAV PHP.eB, AAV Retrograde, AAV1, AAV2, AAV5, AAV8, and AAV9InsertNLS-mRuby2
UseAAVExpressionMammalianPromotermDLX5/6Available SinceAug. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTRIP-SFFV-EGFP-NLS
Plasmid#86677PurposeExpresses nuclear-localized GFP after lentiviral transduction. Can be used to monitor GFP leakage into the cytosol following nuclear envelope rupture events.DepositorInsertEGFP-NLS
UseLentiviralAvailable SinceApril 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Peredox-mCherry-NLS
Plasmid#32384DepositorInsertPeredox-mCherry-NLS
TagsNuclear Localization SeqExpressionMammalianPromoterCMVAvailable SinceSept. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
R4pGWB601_UBQ10p-miniTurbo-YFP-NLS
Plasmid#127370PurposeBinary vector for expressing nuclear miniTurbo-YFP under the UBQ10 promoter in plantsDepositorInsertminiTurbo (BirA mutant)
TagsGS linker, NLS, V5, and YFPExpressionPlantMutationaa1-63 deleted; Q65P, I87V, R118S, E140K, Q141R, …PromoterArabidopsis UBQ10 promoterAvailable SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2 TDP-43 NLS1 YFP
Plasmid#84912PurposeMammalian expresion of TDP-43 NLS1 YFPDepositorAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
CSII-prEF1a-mCherry-3xNLS
Plasmid#125262PurposeFluorescent reporter for cell sizeDepositorInsertmCherry-3xNLS
UseLentiviralTags3xNLSExpressionMammalianPromoterEF1aAvailable SinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-eGFP-NLS-RNF168
Plasmid#133977Purposemammalian expression vector of eGFP tagged wild type RNF168DepositorInsertRNF168 (RNF168 Human)
TagseGFPExpressionMammalianMutationsiRNA resistant sequence: GAGGAGTCGTGTTTATTGAPromoterCMVAvailable SinceNov. 4, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
CAGGS-MCS-NLS-3XFLAG-V5
Plasmid#196383PurposeEmpty backbone vector to insert cDNA for strong expression in mammalian cellsDepositorTypeEmpty backboneTags3xFLAG and V5ExpressionBacterial and MammalianPromoterCAGGsAvailable SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-BRX-eGFP-NLS
Plasmid#217534PurposeAAV vector to drive the expression of eGFP under the control of the 4xBRE regulatory element of SMAD1 and miniXon splicing casette transcription factor in vivoDepositorArticleInsertBMP reporter element and miniXon casette (Smad1 Mouse)
UseAAVExpressionMammalianPromoterBMP Reporter ElementAvailable SinceApril 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
lenti-NLS-miRFP670nano-miRFP670
Plasmid#216131PurposeLentiviral vector for expressing a fusion of miRFP670nano and miRFP670 localizing to the nucleus.DepositorInsertEF1a-NuclearLocalizationSignal-miRFP670nano-miRFP670-WPRE
UseLentiviralExpressionMammalianAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E2-dTom-nlsdTom
Plasmid#135630PurposeAAV vector to drive the expression of dTomato in PV cortical interneurons under the control of the E2 regulatory elementDepositorHas ServiceAAV PHP.eB, AAV1, and AAV9InsertdTom-nlsdTom
UseAAVMutationNoneAvailable SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-ABEMAX-NLS-P2A_BLAST
Plasmid#135355PurposeExpression of ABEMax (wildtype Tada monomer coupled with evolved Tada monomer) with dual C-terminal NLS in a single operon encoding P2A blasticidine resistanceDepositorInsertABEMax-2XNLS
UseCRISPRExpressionMammalianMutationWTAvailable SinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
UBQ10pro-nlsABACUS2-400n-NosT
Plasmid#203728PurposeBinary vector for the transformation of the nlsABACUS2-400n biosensor for (+)-Abscisic acid into ArabidopsisDepositorInsertnlsABACUS2-400n
UseSynthetic BiologyTagsMycExpressionPlantPromoterAtUBQ10pro 1500bpAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
YFP NLS Beta-Actin
Plasmid#60613PurposeEncodes YFP and NLS tagged beta-actinDepositorAvailable SinceNov. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pINO4-NLS-Pfv-Sapphire-HO
Plasmid#203660PurposeYeast vector encoding donor DNA for integration of nuclear 40nm GEMs into the HO locus.DepositorArticleInsertPfV
UseCRISPRTagsSapphireAvailable SinceJuly 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-SAFB-NLS-3XFLAG-V5
Plasmid#196089PurposeExpresses mouse SAFB in mammalian cells. Contains a c-terminal 3xFlag tag and a c-terminal V5 tagDepositorInsertSAFB (Safb Mouse)
TagsC-terminal 3xFLAG and C-terminal V5ExpressionBacterial and MammalianPromoterCAGGSAvailable SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only