We narrowed to 17,281 results for: REV

#87398

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1206a sequence CGAACATTTTTCCATGCGCT in yeast chromosome 12.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87408

p426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87385

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#83537

Constitutive TEF1 promoter mediated expression of the UBiC, ARO4*, and TKL1 genes

Claudia Vickers

Williams et al Metab Eng Commun. 2016 May 11;3:142-152.

Dec. 16, 2016

Academic Institutions and Nonprofits only

#60339

Contains a promoter of three gal binding sites derived from native galactose promoter coupled with a core promoter derived from native Leucine promoter.

Hal Alper

Blazeck et al Biotechnol Bioeng. 2012 Nov;109(11):2884

Feb. 11, 2015

Industry, Academic Institutions, and Nonprofits

#53258

GAL driven LexA-tagged SET1-catalytically dead (H1017K)

Jean Cook

Rizzardi et al Genetics. 2012 Oct;192(2):371-84. doi: 1

June 9, 2014

Academic Institutions and Nonprofits only

#51744

overexpression of Sir2 in S. cerevisiae (P394L mutant), HIS3 marker

Markus Ralser

Ralser et al PLoS One. 2009;4(4):e5376. doi: 10.1371/

March 21, 2014

Academic Institutions and Nonprofits only

#35120

John McCusker

Hartzog et al Yeast. 2005 Jul 30;22(10):789-98.

Aug. 29, 2012

Academic Institutions and Nonprofits only