We narrowed to 6,209 results for: Gaa
-
Plasmid#77508Purpose3rd generation lentiviral gRNA plasmid targeting human CRKLDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
KSR2 gRNA (BRDN0001145237)
Plasmid#76427Purpose3rd generation lentiviral gRNA plasmid targeting human KSR2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_3-As
Plasmid#209033PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_3-Lb
Plasmid#209029PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & LbCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_MDM4_exon_deletion_1
Plasmid#155073PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pADH100Cau
Plasmid#244817PurposeModified plasmid from pADH100 to perform HIS-FLP CRISPR in Candidozyma aurisDepositorInsertSNR52p from C. auris
UseCRISPRTagsHIS1 terminator from C. auris and NAT resistance …ExpressionYeastPromoterSNR52pAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRRL-mouse cGAS #1-gRNA-Cas9-Puro
Plasmid#186890PurposegRNA targeting mouse cGAS (with Cas9 insert)DepositorInsertCas9 (Cgas Mouse)
UseLentiviralAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAPM-miR30-MAVS-ts1
Plasmid#174274PurposeMAVS knockdownDepositorAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAPM-miR30-DDX58-ts3
Plasmid#174243PurposeDDX58 knockdownDepositorAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-3xFLAG-SRSF1 siRNA-resitant
Plasmid#218974PurposeVector for expressing siRNA-resistant SRSF1 cDNA (siRNA sequence: CGUGGAGUUUGUACGGAAA)DepositorInsertSRSF1 cDNA
ExpressionMammalianMutationsiRNA-resistant SRSF1 cDNA (siRNA sequence: CGUGG…PromoterCMVAvailable SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPlacPbuCas13b-gRNA-T-deGFP
Plasmid#184840PurposeExpression of a single-spacer CRISPR array with spacer #1 targeting the mRNA of deGFP and expression of PbuCas13b in bacteria.DepositorInsertsingle-spacer CRISPR array with spacer #1 targeting the the mRNA of deGFP, PbuCas13b nuclease
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterJ23119 and lac promoterAvailable SinceOct. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
KAT2A sgRNA1
Plasmid#138185Purpose3rd generation lentiviral gRNA plasmid targeting human KAT2ADepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFB-U6-Chrna5-gRNA-hSyn-mCherry-WPRE-SV40pA
Plasmid#128340PurposepAAV encoding gRNA sequence for loss-of-function indelsDepositorAvailable SinceJuly 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shMBNL3-0455
Plasmid#115463PurposeConstitutive lentiviral expressionDepositorAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003-sgQKI-2204
Plasmid#115450PurposeConstitutive lentiviral expressionDepositorAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti CRISPR V2 sgShmt2_1
Plasmid#106314PurposeExpress Cas9 and sgRNA targeting mShmt2DepositorAvailable SinceApril 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.1.mKO2
Plasmid#85209PurposeTRCN0000116119 (Target CGACGAAAGGCATGTACCATA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
LATS2 gRNA (BRDN0001147222)
Plasmid#77900Purpose3rd generation lentiviral gRNA plasmid targeting human LATS2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PHKA1 gRNA (BRDN0001144977)
Plasmid#77838Purpose3rd generation lentiviral gRNA plasmid targeting human PHKA1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only