We narrowed to 16,558 results for: GRN
-
Plasmid#244824PurposeMammalian expression of SpyCas9 single guide RNA targeting EMX1DepositorInsertSpyCas9 single guide RNA
UseCRISPRExpressionMammalianPromoterU6Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKMW493_U6-sgRNA-entry
Plasmid#244823PurposeMammalian expression of SpyCas9 single guide RNA with Golden Gate-compatible sgRNA spacerDepositorInsertSpyCas9 single guide RNA
UseCRISPRExpressionMammalianPromoterU6Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT1AR
Plasmid#221820PurposePlasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT1BR
Plasmid#221821PurposePlasmid to express gRNA1 (gaaaatttgatttcaactga) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA1 (5-HT1B Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT1BR
Plasmid#221822PurposePlasmid to express gRNA2 (aatttcgacgggccttcaag) for editing at the end of Drosophila 5-HT1BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT2BR
Plasmid#221827PurposePlasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-d5-HT2BR
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT7R
Plasmid#221829PurposePlasmid to express gRNA (ggcgagggagagctttctct) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-for-dSERT
Plasmid#221830PurposePlasmid to express gRNA1 (cgaaatctgcgctctacttg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-for-dSERT
Plasmid#221831PurposePlasmid to express gRNA2 (gggattcgagcggcccgtcg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs_RPP21 (pAVA3259)
Plasmid#239327PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting RPP21DepositorInsertU6-driven sgRNA1 and 7SK-driven sgRNA2 targeting RPP21 (RPP21 Human)
UseCRISPR and LentiviralAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNS1D-sgRNA9-SpR
Plasmid#191092PurposeaTc inducible gRNA expression plasmid with BbsI sites for Golden Gate insertion of crRNA oligos and homology arms for genome integration at NS1D in Synechococcus sp. PCC 7002DepositorTypeEmpty backboneUseCRISPRExpressionBacterialPromotertetAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
BPK1520-sgRNA GLB1
Plasmid#184378PurposeExpresses a sgRNA to edit GLB1 gene NM_000404.2_c.907A>GDepositorAvailable SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs_BRF2 (pAVA3258)
Plasmid#239326PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting BRF2DepositorInsertU6-driven sgRNA1 and 7SK-driven sgRNA2 targeting BRF2 (BRF2 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs_RPPH1 (pAVA3586)
Plasmid#239328PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting RPPH1DepositorInsertU6-driven sgRNA1 and 7SK-driven sgRNA2 targeting RPPH1 (RPPH1 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_D11 (pAVA3773)
Plasmid#239310PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and a non-targeting sgRNA as control(-)DepositorInsertU6-driven non-targeting sgRNA Control(-)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_POP1 (pAVA3497)
Plasmid#239311PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting POP1DepositorInsertU6-driven sgRNA targeting POP1 (POP1 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_RPP38 (pAVA3523)
Plasmid#239313PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting RPP38DepositorInsertU6-driven sgRNA targeting RPP38 (RPP38 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_RPP29 (pAVA3545)
Plasmid#239314PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting RPP29DepositorInsertU6-driven sgRNA targeting RPP29 (POP4 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_POP5 (pAVA3498)
Plasmid#239315PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting POP5DepositorInsertU6-driven sgRNA targeting POP5 (POP5 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_RPP20 (pAVA3546)
Plasmid#239316PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting RPP20DepositorInsertU6-driven sgRNA targeting RPP20 (POP7 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_RPP14 (pAVA3507)
Plasmid#239317PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting RPP14DepositorInsertU6-driven sgRNA targeting RPP14 (RPP14 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_RPP30 (pAVA3573)
Plasmid#239318PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting RPP30DepositorInsertU6-driven sgRNA targeting RPP30 (RPP30 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_RPP40 (pAVA3540)
Plasmid#239319PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting RPP40DepositorInsertU6-driven sgRNA targeting RPP40 (RPP40 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_RPP25 (pAVA3522)
Plasmid#239320PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting RPP25DepositorInsertU6-driven sgRNA targeting RPP25 (RPP25 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_RPP25L (pAVA3548)
Plasmid#239321PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting RPP25LDepositorInsertU6-driven sgRNA targeting RPP25L (RPP25L Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs_RBM7 (pAVA3250)
Plasmid#239322PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting RBM7DepositorInsertU6-driven sgRNA1 and 7SK-driven sgRNA2 targeting RBM7 (RBM7 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs_SKIV2L2 (pAVA3251)
Plasmid#239323PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting SKIV2L2DepositorInsertU6-driven sgRNA1 and 7SK-driven sgRNA2 targeting SKIV2L2 (MTREX Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs_ZCRB1 (pAVA3300)
Plasmid#239325PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNA stargeting ZCRB1DepositorInsertU6-driven sgRNA1 and 7SK-driven sgRNA2 targeting ZCRB1 (ZCRB1 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_EXOSC10 (pAVA3318)
Plasmid#239295PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting EXOSC10DepositorInsertU6-driven sgRNA targeting EXOSC10 (EXOSC10 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_DDX59 (pAVA3791)
Plasmid#239297PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting DDX59DepositorInsertU6-driven sgRNA targeting DDX59 (DDX59 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_DDX59 (pAVA3796)
Plasmid#239298PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting DDX59DepositorInsertU6-driven sgRNA targeting DDX59 (DDX59 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_DDX59 (pAVA3317)
Plasmid#239299PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting DDX59DepositorInsertU6-driven sgRNA targeting DDX59 (DDX59 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_DDX59 (pAVA3794)
Plasmid#239300PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting DDX59DepositorInsertU6-driven sgRNA targeting DDX59 (DDX59 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2 Neo-MORC3_gRNA_1
Plasmid#235529PurposegRNA against human MORC3DepositorInsertMORC3 (MORC3 Human)
UseLentiviralAvailable SinceJuly 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2 Neo-MORC3_gRNA_3
Plasmid#235530PurposegRNA against human MORC3DepositorInsertMORC3 (MORC3 Human)
UseLentiviralAvailable SinceJuly 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV 3xgRNA KO;Rbfox3
Plasmid#240311PurposeKO:NeuNDepositorInsertKO gRNAs for NeuN
UseAAVMutationNAAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
GE-0010-gRNA2-MpCKB
Plasmid#238528PurposePlant expression of Cas9 and gRNA against M. polymorpha CK2 betaDepositorInsertMpCKB
UseCRISPRExpressionPlantAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
GE-0010-gRNA1-MpCKB
Plasmid#238527PurposePlant expression of Cas9 and gRNA against M. polymorpha CK2 betaDepositorInsertMpCKB
UseCRISPRExpressionPlantAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
GE-0010-gRNA1-MpCKA
Plasmid#238526PurposePlant expression of Cas9 and gRNA against M. polymorpha CK2 alphaDepositorInsertMpCKA
UseCRISPRExpressionPlantAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
MIGR1-U6gRNA1-Filler-v1
Plasmid#237399PurposeFor inserting a single guide RNA or later cloning two U6-gRNA cassettes with MIGR1-U6gRNA1-Filler-v2.DepositorTypeEmpty backboneUseCRISPR and RetroviralExpressionMammalianPromoterU6, PGKAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
MIGR1-U6gRNA2-Filler
Plasmid#237401PurposeFor the sequential insertion of two guide RNAs into two U6gRNA cassettes.DepositorInsertsU6gRNA-1
U6gRNA-2
PGK-TagBFP
UseCRISPR and RetroviralExpressionMammalianPromoterPGK promoter, U6 promoter, and U6, PGKAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
sgRNA Clec12a (CT6)
Plasmid#236203Purposelentiviral expression of Cas9 and encodes CT6 sgRNA for CLEC12A deletionDepositorAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
sgRNA Clec12a (CT44)
Plasmid#236204Purposelentiviral expression of Cas9 and encodes CT44 sgRNA for CLEC12A deletionDepositorAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
sgRNA Clec12a (CT47)
Plasmid#236205Purposelentiviral expression of Cas9 and encodes CT47 sgRNA for CLEC12A deletionDepositorAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458_mCherry-HP1a-gRNA-2
Plasmid#237635PurposeCas9 from S. pyogenes with 2A-mCherry, gRNA to knock-in msfGFP to HP1a locusDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458_mCherry-HP1a-gRNA-1
Plasmid#237634PurposeCas9 from S. pyogenes with 2A-mCherry, gRNA to knock-in msfGFP to HP1a locusDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
Halo XLF sgRNA
Plasmid#207605PurposesgRNA for the insert of the HaloTag at the endogenous loci of XLFDepositorInsertGTTCTTCCATctgcaaaaaa
TagsNoneExpressionMammalianAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX458-eBFP2-sgRNA_CTCF_ZF1
Plasmid#233090PurposeExpression vector for a sgRNA against the mouse CTCF ZF1 region and SpCas9-T2A-eBFP2.DepositorInsertspCas9-T2A-eBFP2 (Ctcf )
ExpressionMammalianAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only