We narrowed to 9,286 results for: sgRNA
-
Plasmid#160137PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #2DepositorInsertSpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available sinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
NmCas9_sgRNA_expression_in_pBluescript
Plasmid#122091PurposeU6 driven NmCas9 sgRNA expression vector for cloning own guidesDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertNmCas9 tracrRNA (NEWENTRY Synthetic, S. pyogenes)
UseCRISPRExpressionMammalianPromoterU6Available sinceApril 18, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
SpCas9_sgRNA_expression_in_pBluescript
Plasmid#122089PurposeU6 driven SpCas9 sgRNA expression vector for cloning own guidesDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSpCas9 tracr (NEWENTRY Synthetic, S. pyogenes)
UseCRISPRExpressionMammalianPromoterU6Available sinceApril 18, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PRINCE-SpCas9-2
Plasmid#250956PurposePRINCE drug inducible gene editing system based on SpCas9 (Lentiviral-Part II: the sgRNA expression is under drug-mediated control)DepositorInsertH1-TetO-SpCas9 sgRNA scaffold; EF1α-optTetR
UseCRISPR and LentiviralExpressionMammalianPromoterH1 promoter; EF1α promoterAvailable sinceJuly 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lentivirus ABE8e-V106W targeting PEX1-G843D
Plasmid#247667PurposeLentivirus genome encoding ABE8eV106W editor and Sp sgRNA cassette targeting PEX1-G843D mutationDepositorInsertABE8e-V106W editor and PEX1-G843D-targeting sgRNA
UseLentiviralExpressionMammalianPromoterEFSAvailable sinceApril 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
zCREST3:Cas9green; T2_gRNA
Plasmid#197647PurposepDEL160; transgenic construct to express cell-specific Cas9 in sensory neurons; ubiquitous nrg1 type II sgRNADepositorInsertszCREST3
Cas9
nrg1 type II sgRNA
UseTol2 destination vectorAvailable sinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
zCREST3:Cas9green; T1_gRNA
Plasmid#199332PurposepDEL159; transgenic construct to express cell-specific Cas9 in sensory neurons; ubiquitous nrg1 type I sgRNADepositorInsertszCREST3
Cas9
nrg1 type I sgRNA
UseTol2 destination vectorAvailable sinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
px330-Pten-2
Plasmid#162552PurposesgRNA targeting PtenDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting Pten (Pten Mouse)
ExpressionMammalianMutationNonePromoterU6Available sinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Puro-V2.0-sgHsNot1_AH
Plasmid#148856PurposeMammalian Expression of HsNot1-sgRNADepositorAvailable sinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX601-miniCMV-SaCas9-U6-YFPvsSaCas9 sgRNA
Plasmid#107050PurposeAll-in-one vectors expressing both SaCas9 and YFP sgRNADepositorInsertSaCas9
UseAAV and CRISPRExpressionMammalianAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCnCas12f1HS_sgRNA_MS13_empty
Plasmid#204999PurposeCnCas12f1 with MS13 sgRNA site for Human cell genome editingDepositorTypeEmpty backboneUseCRISPRAvailable sinceAug. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
NOLC1 nicking guide pDY2251
Plasmid#219861PurposeNicking sgRNA for NOLC1DepositorInsertNOLC1 nicking sgRNA (NOLC1 Human)
UseCRISPRAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFH101
Plasmid#128206PurposesgRNA backbone for StCas9, combine with AtU6-26 promoter module (pFH35)DepositorInsertsgRNA backbone for StCas9, combine with AtU6-26 promoter module (pFH35)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable sinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
Reckleen_3plus_sgRNA_ptet_pos5a
Plasmid#233461PurposeLevel 1 part, Ptet sfgfp dropout sgRNA for position 5a, for building RECKLEEN plasmid with multiple sgRNAsDepositorInsertLevel 1 part, Ptet sfgfp dropout sgRNA for position 5a, ColE1 ori, and KanR.
UseCRISPRAvailable sinceApril 24, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
Reckleen_3plus_sgRNA_ptet_pos5b
Plasmid#233464PurposeLevel 1 part, Ptet sfgfp dropout sgRNA for position 5b, for building RECKLEEN plasmid with multiple sgRNAsDepositorInsertLevel 1 part, Ptet sfgfp dropout sgRNA for position 5b, ColE1 ori, and KanR.
UseCRISPRAvailable sinceApril 24, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
enDelIscB-T5E
Plasmid#247330PurposeVector encoding human codon-optimized engineered DelIscB fused with T5E at C-terminal driven by CAG promoter, optimized sgRNA (sgRNA-V5) driven by hU6, and mCherry driven by CMV promoterDepositorInsertpCAG_enDelIscB-T5E_npNLS_polyA_pU6_sgRNA_V5-BsaI_pCMV_mCherry
ExpressionMammalianAvailable sinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_TIA1
Plasmid#106097PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting TIA1DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA TIA1
UseCRISPRAvailable sinceAug. 28, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
px458_2A_GFP_sgRNA_ELAVL1
Plasmid#106106PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting ELAVL1DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA targeting ELAVL1 (ELAVL1 Human)
UseCRISPRAvailable sinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgNADK2
Plasmid#233897Purposelentiviral vector expressing Cas9 and an sgRNA targeting NADK2DepositorInsertsgRNA targeting NADK2 (NADK2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO1-puro-U6-sgRNA-PLXNB2
Plasmid#69240PurposeU6 driven SpCas9 sgRNA expression for PLXNB2 siteDepositorAvailable sinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only