We narrowed to 2,699 results for: dap
-
Plasmid#213025PurposeExpresses full length human LINE-1 ORF2p Core (1-1275) with a C-terminal 3xFlag tag for baculovirus production in insect cellsDepositorInsertLINE-1 ORF2p (1-1275)
Tags3C-3xFlag (ORF2p)ExpressionInsectPromoterPolyhedrinAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMT647 human L1 ORF2p-3xFlag only (ORFeus-Hs, CMV promoter, monocistronic construct) in pCEP4 Puro (derivative of pMT646)
Plasmid#213029PurposeExpresses human LINE-1 ORF2 only in human cells (codon optimized ORFeus-Hs), with a C-terminal 3xFlag tag on ORF2DepositorInsertHuman LINE-1 ORF2p only (monocistronic, codon optimized ORFeus-Hs sequence) with ORF2-3xFlag
Tags3xFlagExpressionMammalianPromoterCMVAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMT1093 human L1 EN- (ORF2p E43S, D145N) ORF2p-3xFlag (ORFeus-Hs, CMV promoter) in pCEP4 Puro (derivative of pMT646)
Plasmid#213028PurposeExpresses endonuclease dead (EN- ORF2p E43S, D145N) full length human LINE-1 in human cells (codon optimized ORFeus-Hs), with a C-terminal 3xFlag tag on ORF2DepositorInsertHuman LINE-1 (ORFeus-Hs codon optimized sequence, EN- E43S D145N) with ORF2-3xFlag
Tags3xFlag (ORF2p)ExpressionMammalianMutationE43S D145N double mutant EN- endonuclease catalyt…PromoterCMVAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMT870 human L1 RT- (ORF2p D702Y) ORF2p-3xFlag (ORFeus-Hs, CMV promoter) in pCEP4 Puro (derivative of pMT646)
Plasmid#213027PurposeExpresses reverse transcriptase dead (RT- ORF2p D702Y) full length human LINE-1 in human cells (codon optimized ORFeus-Hs), with a C-terminal 3xFlag tag on ORF2DepositorInsertHuman LINE-1 (ORFeus-Hs codon optimized sequence, RT- D702Y) with ORF2-3xFlag
Tags3xFlag (ORF2p)ExpressionMammalianMutationD702Y (RT- reverse transcriptase catalytic dead)PromoterCMVAvailable SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-MAPK3
Plasmid#23509DepositorInsertMAPK3 (MAPK3 Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pSA1
Plasmid#52261PurposeBacterial expression of human 6His-tagged SUMO1 and SUMO-E1DepositorTags6His-tagExpressionBacterialMutationC-terminal gly-glyPromoterT7 and rbsAvailable SinceJuly 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSUMO1
Plasmid#52258PurposeBacterial expression of human 6His-tagged SUMO1, SUMO-E1 and SUMO-E2DepositorTags6His-tagExpressionBacterialMutationC-terminal gly-glyPromoterT7 and rbsAvailable SinceJuly 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
RHO3
Bacterial Strain#124700PurposeE. coli mobilizer strain that facilitates conjugation of mobilizable plasmids by using metabolic counter-selection against the donor strain.DepositorBacterial ResistanceDAP (400 µg/ml)Available SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
Human Kinase Domain Constructs for Automated Bacterial Expression
Plasmid Kit#1000000094Purpose68 His-tagged human kinase catalytic domain constructs and the respective phosphatases that enhance their bacterial expression; optimized for automated bacterial expressionDepositorAvailable SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
T-B18
Bacterial Strain#159446PurposeE. coli BW25113 ΔfrmA, harboring plasmid Addgene plasmid # 129104, was adaptively evolved to grow efficiently on threonine and perform significant biosynthesis while employing methanol-derived carbonBacterial ResistanceAmpicillin and KanamycinAvailable SinceAug. 18, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBP-P_phlF-PPhlF
Plasmid#204075PurposeType 0 promoter partDepositorInsertphlF repressor and PPhlF DAPG-inducible promoter
ExpressionBacterialMutationNoneAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBP-P_TALEsp1_PUPsp1-phlF_PPhlF
Plasmid#204080PurposeType 0 promoter partDepositorInsertTALEsp1-stabilized promoter driving phlF repressor; PPhlF DAPG-inducible promoter
ExpressionBacterialMutationNoneAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
mr-GST full length
Plasmid#112982PurposeFor protein expression and purification of full-length Drosophila mr (APC2)DepositorInsertmr (APC2) (mr Fly)
ExpressionBacterialAvailable SinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-TRAM-CFP
Plasmid#13027DepositorAvailable SinceNov. 3, 2006AvailabilityAcademic Institutions and Nonprofits only -
pOpen-K12polLF (exo-)
Plasmid#165522PurposeDNA pol fragment used in flourescent labelling for microarray, dA and dT tailing, and ligating DNA adapters to DNA fragments.DepositorInsertDNA Polymerase I, Large (Klenow) Fragment (3'-5' exo-)
UseSynthetic BiologyAvailable SinceDec. 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
hPLD3-sgRNA-Cas9_mcherry
Plasmid#199342Purposeencodes sgRNA for human PLD3 KO, (target Exon 7) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-RFPExpressionMammalianPromoterhuman U6Available SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
hPLD4-sgRNA-Cas9_mcherry
Plasmid#199343Purposeencodes sgRNA for human PLD4 KO, (target Exon 5) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-mCherryExpressionMammalianMutationsgRNA: accagtagtatgaagccacgPromoterhuman U6Available SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTHAP12-donor
Plasmid#176348PurposeCRISPR donor plasmid to create GFP fusion proteinsDepositorAvailable SinceNov. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
mr-GST N-term fusion
Plasmid#112983PurposeFor protein expression and purification of N-terminus of Drosophila mr (APC2)DepositorAvailable SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
AbVec_IGHC
Plasmid#183701PurposeEncode human IgG1 heavy chain constant region. For cloning variable region and mAb expression.DepositorAvailable SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only