We narrowed to 19,561 results for: Comp;
-
Plasmid#129644PurposeExpress APEX2 fusion to cap-binding protein eIF4E1 in mammalian cellsDepositorAvailable SinceAug. 26, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pcDNA3.1(+)-RIα-EGFP
Plasmid#181840PurposeGFP-tagged PKA RIα subunit for mammalian expression.DepositorAvailable SinceJune 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3/Flag-METTL3
Plasmid#53739PurposeFor expression of METTL3 (methyltransferase-like 3) in human cellsDepositorAvailable SinceOct. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBrain-GFP-TACC3KDP-shTACC3
Plasmid#59356PurposeKnocks down endogenous TACC3 and re-expresses knockdown-proof (RNAi-resistant) GFP-tagged human TACC3.DepositorInsertTransforming Acidic Coiled Coil protein 3 (TACC3 Human)
UseRNAiTagsGFPExpressionMammalianMutationSilent mutations in amino acids 30-33 to confer s…PromoterCMVAvailable SinceDec. 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-CasRx-P2A-mCherry-pA
Plasmid#233025PurposeTo Express HA tagged CasRX and mcherry from the mammalian EFS promoter. The CasRx and mCherry are separated by a P2A siteDepositorInsertCasRx/mCherry
UseAAVTagsmCherryAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-mCherry-ATG14
Plasmid#203567PurposeMammalian expression of mCherry tagged ATG14DepositorAvailable SinceJuly 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBABE-EGFP-THAP11-rescue-3xFLAG
Plasmid#37000DepositorInsertTHAP11 (THAP11 Human)
UseRetroviralTags3xFLAGExpressionMammalianMutationMutations were generated at codons 273-275 conver…Available SinceMay 21, 2012AvailabilityAcademic Institutions and Nonprofits only -
Braf
Plasmid#40775DepositorAvailable SinceOct. 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEBTet-SNAP-Centrobin
Plasmid#136829PurposeMammalian expression of the centrosomal protein Centrombin N-terminally fused to SNAP-tagDepositorInsertSNAP-Centrobin (CNTROB Synthetic, Human)
TagsFLAG-tag / His-tagExpressionMammalianPromoterCMV-TetO2Available SinceMarch 27, 2020AvailabilityAcademic Institutions and Nonprofits only