We narrowed to 61,682 results for: SAP
-
Plasmid#70469PurposeGateway ORF clone of human PLXNB1 [NM_001130082.2] with stop codon (for native or N-terminal fusions)DepositorInsertPLXNB1 (PLXNB1 Human)
UseGateway entry cloneAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
SPLICSFAST-PO-MT-P2A
Plasmid#214899PurposeExpresses equimolar Peroxisome- and Mitochondria- targeted split-FAST fragments for Short-range PO-MT Contact sitesDepositorInsertSPLICSFAST-PO-MT-P2A
TagsnoneExpressionBacterial and MammalianAvailable SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYZ205
Plasmid#104586PurposeExpress SNAP-6His-CBDDepositorInsertSNAP-6His-CBD
ExpressionBacterialPromoterT7Available SinceJan. 4, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits -
SPLICSFAST-NU-MT-P2A
Plasmid#214898PurposeExpresses equimolar Nucleus- and Mitochondria- targeted split-FAST fragments for Short-range NU-MT Contact sitesDepositorInsertSPLICSFAST-NU-MT-P2A
TagsnoneExpressionBacterial and MammalianAvailable SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tubulin-C-18
Plasmid#58197PurposeLocalization: Microtubules, Excitation: N/A, Emission: N/ADepositorAvailable SinceJan. 13, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pZBTB4-donor
Plasmid#176374PurposeCRISPR donor plasmid to create GFP fusion proteinsDepositorAvailable SinceNov. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
856 pBabe puroL PTEN C124S
Plasmid#10931DepositorAvailable SinceFeb. 14, 2006AvailabilityAcademic Institutions and Nonprofits only -
R777-E231 Hs.RASA3
Plasmid#70515PurposeGateway ORF clone of human RASA3 [NM_007368.2] with stop codon (for native or N-terminal fusions)DepositorInsertRASA3 (RASA3 Human)
UseGateway entry cloneAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
-
pcDNA3.1-hRIPK1-Flag
Plasmid#112487PurposeMammalian expression of Flag-hRIPK1. Please note Flag tag is N-terminal.DepositorAvailable SinceJuly 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
R777-E221 Hs.RALGDS
Plasmid#70505PurposeGateway ORF clone of human RALGDS [NM_006266.3] with stop codon (for native or N-terminal fusions)DepositorInsertRALGDS (RALGDS Human)
UseGateway entry cloneAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro-hPPM1A
Plasmid#185382PurposeFor mammalian expression of shRNA: AGGGTAATGGGTTGCGATATG that targets human PPM1ADepositorAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
mEmerald-TPT1-C-10
Plasmid#54283PurposeLocalization: Microtubule Associated Protein, Excitation: 487, Emission: 509DepositorAvailable SinceJuly 10, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pIVTR(T7A)-NGN2 (SA Substitutions)
Plasmid#172308PurposeIn vitro transcription of NGN2 (Ser phosphosites substituted by Ala)DepositorInsertNGN2
UseOtherMutationS24A, S193A, S207A, S209A, S219A, S232A, S239A an…PromoterT7 promoter A-initiatingAvailable SinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
R777-E245 Hs.RASGRP2
Plasmid#70529PurposeGateway ORF clone of human RASGRP2 [NM_153819.1] with stop codon (for native or N-terminal fusions)DepositorInsertRASGRP2 (RASGRP2 Human)
UseGateway entry cloneAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1 puro PTEN shRNA
Plasmid#10669DepositorAvailable SinceJan. 6, 2006AvailabilityAcademic Institutions and Nonprofits only -
1056 pSG5L HA PTEN 380-385E
Plasmid#11171DepositorAvailable SinceJan. 3, 2006AvailabilityAcademic Institutions and Nonprofits only -
MSCV-Six1
Plasmid#49263Purposeretroviral expression of human Six1 and GFPDepositorAvailable SinceNov. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCLXSN(GFP)-hp100
Plasmid#174734PurposeGene overexpressionDepositorAvailable SinceSept. 20, 2021AvailabilityAcademic Institutions and Nonprofits only