We narrowed to 8,952 results for: aav
-
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVExpressionMammalianPromoterCAGAvailable sinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-eYFP-f
Plasmid#104057PurposeAn AAV genome with tet-inducible, Cre-dependent expression of the fluorescent protein eYFP with a C-terminal Hras farnesylation sequenceDepositorInsertEYFP-f
UseAAVPromoterTREAvailable sinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1 gfaABC1D-eGFP
Plasmid#176861PurposeExpresses cytosolic eGFP in astrocytesDepositorInserteGFP
UseAAVExpressionBacterialPromotergfaABC1DAvailable sinceApril 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-Axon-jGCaMP8m
Plasmid#172719PurposeAAV transfer plasmid for neuronal expression of axon-targeted jGCaMP8m.DepositorInsertAxon-jGCaMP8m
UseAAVTags6xHisExpressionMammalianPromoterhSynAvailable sinceDec. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-FLEX-CAG-CyRFP1
Plasmid#84357PurposeExpresses CyRFP1 fluorescent protein in an AAV backbone, FLEX version (Cre dependent)DepositorInsertCyRFP1
UseAAVExpressionMammalianMutationDouble FLEXedPromoterCAGAvailable sinceNov. 22, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV_BiSSTe4_Gq_dTomato
Plasmid#213946PurposeAAV construct expressing HA-hM3Dq-dTomato driven by SST interneuron-targeting enhancer. Alias: pAAV_WDS0004_Gq_dTomatoDepositorInsertHA-GqDREADD-dTomato
UseAAVAvailable sinceJuly 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorPublicationInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available sinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-mNeonGreen
Plasmid#191208PurposemNeonGreen expression under the control of TRE promotorDepositorInsertmNeonGreen
UseAAVExpressionMammalianPromoterTREAvailable sinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CamKII-GFP
Plasmid#182737PurposeGFP expression under the control of CamKII promotorDepositorInsertGFP
UseAAVPromoterCamKIIAvailable sinceApril 29, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-CMV-SpyCas9
Plasmid#113034PurposeAAV vector for expression of SpyCas9 in mammalian cellsDepositorInsertSpyCas9
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable sinceOct. 30, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAG AAV CMV Empty
Plasmid#242957PurposeEmpty AAV expression backboneDepositorTypeEmpty backboneUseAAVPromoterCMVAvailable sinceNov. 13, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-CAG-Flex-Rev-TdTomato
Plasmid#122501PurposeCre-dependent TdTomato expression.DepositorInsertTdTomato
UseAAVPromoterCAGAvailable sinceMarch 22, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-hSyn-BRIC
Plasmid#172341PurposeAAV transfer plasmid for BRIC (Bioluminescent Red Indicator for Calcium)DepositorInsertBRIC
UseAAVPromoterhSyn promoterAvailable sinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV asyn S129E
Plasmid#36068DepositorAvailable sinceJuly 13, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV_CKAR3
Plasmid#238413PurposeAAV construct with CKAR3 expression under a human synapsin promotor and WPRE3 translation enhancer.DepositorInsertCKAR3 (PKC sensor)
UseAAVExpressionMammalianAvailable sinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVExpressionMammalianPromoterCAGAvailable sinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV8R-12 Capsid
Plasmid#213968PurposeAAV packaging vector carrying AAV2 rep gene and Cap8R modified AAV8 capsid coding sequenceDepositorTypeEmpty backboneUseAAVAvailable sinceMarch 7, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-CMV-dSa-VPR mini.-2X snRP1
Plasmid#99688PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains with 34 nt dual snRP1 poly adenylation signalDepositorPublicationInsertdCas9
UseAAVTagsVPR miniMutationdead Cas9Available sinceOct. 24, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pOTTC1328 - pAAV EF1a HA-hM3D(Gq)
Plasmid#89149PurposeAn AAV packaging plasmid that expresses HA-tagged hM3D(Gq) excitatory DREADD from the EF1a promoter.DepositorInserthM3D(Gq)
UseAAVTagsHAExpressionMammalianPromoterEF1aAvailable sinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pBK1290-AAV-dSaCas9
Plasmid#223139PurposeAAV backbone for dSaCas9 (endonuclease dead Cas9 from Staphylococcus aureus) and Sa-gRNA ScaffoldDepositorTypeEmpty backboneUseAAV and CRISPRTags3xFLAGExpressionMammalianAvailable sinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only