We narrowed to 9,022 results for: aav
-
Plasmid#213039PurposeAAV backbone for Golden Gate assembly of donor templates using BbsI/BpiI (overhangs AGCG and GCAA, respectively)DepositorTypeEmpty backboneUseAAV; Vector for golden gate assemblyTagsN/APromoterN/AAvailable sinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pssAAV_Seq17_CMV_bglobin_3NLS_Venus_WPRE_polyA
Plasmid#220224PurposeAAV-STARR-seq validation control vector with VenusDepositorTypeEmpty backboneUseAAVExpressionMammalianPromoterCMVAvailable sinceJuly 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV gfaABC1D NES-jRCaMP1a
Plasmid#171120PurposeAstrocyte AAV-mediated expression of jRCaMP1a, a red fluorescent calcium sensor protein.DepositorInsertjRCaMP1a
UseAAVTagsHis Tag, T7 Tag, XpressTagExpressionMammalianPromotergfaABC1DAvailable sinceJuly 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-DeltaFosB
Plasmid#68545PurposeAAV expression of DeltaFosBDepositorInsertDeltaFosB-IRES-GFP
UseAAVExpressionMammalianMutationtruncated splice variant of FosBPromoterCMVAvailable sinceJuly 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV_CK8e_Cas9_miniPA
Plasmid#226141PurposeAAV construct for HITI insert with CK8e promoter and SpCas9DepositorInsertCas9
UseAAV and CRISPRExpressionMammalianPromoterCK8eAvailable sinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-Mito-HyPerGRt
Plasmid#173198PurposeAAV transfer plasmid for a HyPer7 and tdTomato fusion under hSyn promoterDepositorInsertHyper7-tdTomato
UseAAVPromoterhSynAvailable sinceMarch 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR708-5p-TS
Plasmid#117381PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neuronsDepositorInsertEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
UseAAVExpressionMammalianPromoterCAGAvailable sinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVExpressionMammalianPromoterCAGAvailable sinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-eYFP-f
Plasmid#104057PurposeAn AAV genome with tet-inducible, Cre-dependent expression of the fluorescent protein eYFP with a C-terminal Hras farnesylation sequenceDepositorInsertEYFP-f
UseAAVPromoterTREAvailable sinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
ssAAV-EF1a-FLuc-WPRE-HgHpA_bac_293
Plasmid#118412PurposeExpresses firefly luciferase under the control of a strong ubiquitous promoter EF1a along with a WPRE cassette. Backbone is compatible with both baculoviral and human production methods of AAV.DepositorInsertFirefly luciferase
UseAAV, Luciferase, and Synthetic BiologyExpressionInsect and MammalianPromoterEF1aAvailable sinceNov. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV_K700E_hSF3B1
Plasmid#176591PurposeAdenoviral construct to change K to E at 700th amino acid (K700E) in human SF3B1DepositorInsertSF3B1 (SF3B1 Human)
UseAAVAvailable sinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
AAV-hSyn-Axon-jGCaMP8m
Plasmid#172719PurposeAAV transfer plasmid for neuronal expression of axon-targeted jGCaMP8m.DepositorInsertAxon-jGCaMP8m
UseAAVTags6xHisExpressionMammalianPromoterhSynAvailable sinceDec. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-FLEX-CAG-CyRFP1
Plasmid#84357PurposeExpresses CyRFP1 fluorescent protein in an AAV backbone, FLEX version (Cre dependent)DepositorInsertCyRFP1
UseAAVExpressionMammalianMutationDouble FLEXedPromoterCAGAvailable sinceNov. 22, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorPublicationInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available sinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiSSTe4_Gq_dTomato
Plasmid#213946PurposeAAV construct expressing HA-hM3Dq-dTomato driven by SST interneuron-targeting enhancer. Alias: pAAV_WDS0004_Gq_dTomatoDepositorInsertHA-GqDREADD-dTomato
UseAAVAvailable sinceJuly 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-mNeonGreen
Plasmid#191208PurposemNeonGreen expression under the control of TRE promotorDepositorInsertmNeonGreen
UseAAVExpressionMammalianPromoterTREAvailable sinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CamKII-GFP
Plasmid#182737PurposeGFP expression under the control of CamKII promotorDepositorInsertGFP
UseAAVPromoterCamKIIAvailable sinceApril 29, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-CMV-SpyCas9
Plasmid#113034PurposeAAV vector for expression of SpyCas9 in mammalian cellsDepositorInsertSpyCas9
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable sinceOct. 30, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-CAG-Flex-Rev-TdTomato
Plasmid#122501PurposeCre-dependent TdTomato expression.DepositorInsertTdTomato
UseAAVPromoterCAGAvailable sinceMarch 22, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-hSyn-BRIC
Plasmid#172341PurposeAAV transfer plasmid for BRIC (Bioluminescent Red Indicator for Calcium)DepositorInsertBRIC
UseAAVPromoterhSyn promoterAvailable sinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only