We narrowed to 2,014 results for: cp
-
Plasmid#140643PurposeAcetylcholine sensor for sindbis virusDepositorArticleInsertAch sensor V9
ExpressionMammalianPromoterSP6Available SinceApril 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDHa_mDDX5_FL_wt
Plasmid#88869Purposeconstitutive expression of Ha-DDX5 in mammalian cellsDepositorAvailable SinceJune 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDHa_mDDX5_FL_K144N
Plasmid#88870Purposeconstitutive expression of Ha-DDX5 K144N in mammalian cellsDepositorAvailable SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pYEE
Plasmid#159750PurposeEgg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter). Selection of transgenic seeds by YFP fluoresce.DepositorArticleInsertgRNA scaffold
UseCRISPRExpressionPlantAvailable SinceOct. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSems-leader-SNAPf-mEGFPe-IFNAR1(28-557)
Plasmid#187844PurposeExpression of SNAPf and mEGFPe-tagged IFNAR1 at the plasma membrane, e.g. for single molecule fluorescence microscopyDepositorInsertIFNAR1 (IFNAR1 Human)
TagsIg k-chain leader sequence, SNAPf-tag, and meGFPe…ExpressionMammalianMutationmeGFPe: asparagine 198 to aspartic acid and tyros…PromoterCMVAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn syph-GFP-myc-BoNT/B(1-146)-iLID
Plasmid#122981PurposeAAV plasmid with human synapsin promoter driving synaptophysin fused to GFP, iLID(V416I) and BoNT/B amino acids 1-146. Co-express with SSPB-BoNT(147-441, Y365A) for vPA-BoNTDepositorInsertSyph-GFP-myc-BoNT/B(1-146)-iLID (Syp Synthetic, Rat)
UseAAVTagsGFPExpressionMammalianPromoterhuman synapsinAvailable SinceMarch 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSems-leader-SNAPf-mXFPe-IFNAR1(28-557)
Plasmid#192785PurposeExpression of SNAPf and mXFPe-tagged IFNAR1 at the plasma membrane, e.g. for single molecule fluorescence microscopyDepositorInsertIFNAR1 (IFNAR1 Human)
TagsIg k-chain leader sequence, SNAPf-tag, and mXFPeExpressionMammalianMutationmXFPe: tyrosine 66 to phenylalanine, asparagine 1…PromoterCMVAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTEE
Plasmid#159748PurposeEgg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter). Selection of transgenic seeds by mTomato fluoresce.DepositorArticleInsertgRNA scaffold
UseCRISPRExpressionPlantAvailable SinceOct. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
TMEM216-mCherry
Plasmid#41633DepositorAvailable SinceApril 24, 2013AvailabilityAcademic Institutions and Nonprofits only