We narrowed to 32,618 results for: fer
-
Plasmid#140102PurposeCRISPR-Cas9 library validationDepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralPromotergRNA1 under U6 and gRNA2 under H1Available SinceApril 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBullet-pm-c
Plasmid#53078Purposedestination vector with PIP2a-ECFP (plasma membrane marker) for tagged fluorescent protein (C-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pmiRGLO-SERINC2-202
Plasmid#117364PurposeDual luciferase assay for miRNA-targeted UTRDepositorInsert3' UTR SERINC2-202
UseLuciferaseTagsluciferaseExpressionMammalianPromoterMurine PGK-1Available SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_mCherry_Rat_cebp-alfa
Plasmid#140098PurposeCRISPR-Cas9 library validation (positive control)DepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralPromotergRNA1 under U6 and gRNA2 under H1Available SinceApril 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_mCherry_SPI1
Plasmid#140099PurposeCRISPR-Cas9 library validation (positive control)DepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralPromotergRNA1 under U6 and gRNA2 under H1Available SinceApril 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPKm-245
Plasmid#90503PurposeExpresses HO1, PCYA, FD and FNR, required for PCB synthesis. pSIN - EF-1alpha - MTS - tHO1 - P2A - MTS - tPCYA - P2A - MTS - tFD - P2A - MTS - tFNRDepositorInsertmito-tHO1, mito-tPCYA, mito-tFD, mito-tFNR
UseLentiviralAvailable SinceApril 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPKm-244
Plasmid#90502PurposeExpresses HO1, PCYA, FD and FNR, required for PCB synthesis. pSIN - EF-1alpha - MTS - tHO1 - P2A - MTS - tPCYA - IRES - MTS - tFD - P2A - MTS - tFNRDepositorInsertmito-tHO1, mito-tPCYA, mito-tFD, mito-tFNR
UseLentiviralAvailable SinceApril 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
sTR056
Plasmid#177369PurposeToehold switch, with an unpaired toehold region at the 5′-end that interacts with the trigger RNA (sTR060, Addgene plasmid # 177370) to unfold the switch.DepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pmiRGLO-BAX-201
Plasmid#117332PurposeDual luciferase assay for miRNA-targeted UTRDepositorInsert3' UTR BAX-201
UseLuciferaseTagsluciferaseExpressionMammalianPromoterMurine PGK-1Available SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTRIP-SFFV-GFP-RELA K5R
Plasmid#196631PurposeExpress GFP-RELA K5RDepositorAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCOCK CM-R03
Plasmid#46567PurposeMammalian expression plasmid with EGFP expressed from synthetic promoter (random mutagenesis of CMVwt 3' end).DepositorInsertCMV mutant promoter
UseSynthetic BiologyExpressionMammalianMutationMutant version of CMV promoter (refer to Table 1 …Available SinceSept. 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGL-p21UTRm2
Plasmid#20879DepositorInsertp21 3'UTR site 2 mutation (Cdkn1a Mouse)
UseLuciferaseExpressionMammalianMutationPredicted miRNA binding site 2 (Position ~1100) G…Available SinceMarch 12, 2012AvailabilityAcademic Institutions and Nonprofits only -
pPKm-112
Plasmid#90494PurposepcDNA3 - pCMV - MTAD - PIF3, expresses Phytochrome interacting factor 3 (PIF3) and minimal transactivation domain (MTAD), under CMV promoterDepositorInsertMTAD-PIF3
ExpressionMammalianAvailable SinceDec. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCOCK CM-R05
Plasmid#46568PurposeMammalian expression plasmid with EGFP expressed from synthetic promoter (random mutagenesis of CMVwt 3' end).DepositorInsertCMV mutant promoter
UseSynthetic BiologyExpressionMammalianMutationMutant version of CMV promoter (refer to Table 1 …Available SinceSept. 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pPKm- 226
Plasmid#90497PurposepcDNA3 - CMVmin - PIF3 - VPR expresses PIF3 and VPR transactivator domain , under CMV promoterDepositorInsertPIF3-VP64
ExpressionMammalianAvailable SinceJan. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-161K enhancer-ETS-CORE-MUT-minP:fLuc-TK:rLuc
Plasmid#138367PurposeLentiviral plasmid contains 161k modified human enhancer with with ETS binding sites mutated driving firefly Luciferase 2 and Renilla Luciferase driven by TK promoterDepositorInsert161K human enhancer, with ETS binding sites mutated, driving firefly enhancer and TK driving refills luciferase
UseLentiviralExpressionMammalianAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
p3E-DysF
Plasmid#109544PurposeMultisite gateway vector for 3' tagging with DysferlinDepositorAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL2-HKII-A
Plasmid#64513PurposeAS-30D hepatoma hexokinase II 4.3 kbp promoter-luciferase reporter vectorDepositorInsertType II hexokinase gene, partial cds and promoter region (Hk2 Rat)
UseLuciferaseTagsfirefly luciferaseMutationIsolated from AS-30D rat hepatomaPromoterHexokinase IIAvailable SinceJuly 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCOCK CM-C02
Plasmid#46563PurposeMammalian expression plasmid with EGFP expressed from synthetic promoter (CMVwt CAAT box mutant).DepositorInsertCMV mutant promoter
UseSynthetic BiologyExpressionMammalianMutationMutant version of CMV promoter (refer to Table 1 …Available SinceSept. 23, 2013AvailabilityAcademic Institutions and Nonprofits only