We narrowed to 4,956 results for: Gca
-
Plasmid#126041PurposeIn-vitro-transcription of SMN1-exon7-ESE1 RNA in NMR tube for "Systems NMR" analysisDepositorInsertSMN1 exon7 ESE1
Available SinceMay 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330-Esrrb gRNA
Plasmid#128841PurposegRNA for targeting mouse Esrrb locus using CRISPR-cas techniqueDepositorInsertEsrrb gRNA (Esrrb Mouse)
UseCRISPRAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pX330-sgRNA_Drosha_1
Plasmid#79860PurposeCRISPR/Cas9 DROSHADepositorInsertsgRNA Drosha
UseCRISPR and Mouse TargetingExpressionBacterial and MammalianAvailable SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-sgRNA_Drosha_4
Plasmid#79863PurposeCRISPR/Cas9 DROSHADepositorInsertsgRNA Drosha
UseCRISPR and Mouse TargetingExpressionBacterial and MammalianAvailable SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - Amplicon, JAK2 sgRNA 2
Plasmid#70660PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an intergenic JAK2 amplicon-targeting sgRNA element from U6 promoter. Lentiviral backboneDepositorInsertsgRNA against JAK2 amplicon found in AML-derived HEL cell line (JAK2 )
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
OgeuIscB CAG RNA
Plasmid#222867PurposeThis plasmid codes for the guide of the OgeuIscB with a CAG targetDepositorInsertOgeuIscB omega RNA with a (CAG)6 target sequence
UseCRISPRExpressionMammalianPromoterHuman U6Available SinceOct. 16, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLentiCRISPR-v1-sgDHFR
Plasmid#233898Purposelentiviral vector expressing Cas9 and an sgRNA targeting DHFRDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOC2 Tubb3-GFP KI
Plasmid#183432PurposeCreOFF knock-in for beta3-tubulin-GFP (amino acid position: stop codon)DepositorInsertgRNA and GFP donor
UseCRISPRAvailable SinceApril 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28-sfGFP-DogTag Loop B
Plasmid#171780PurposeExpresses in bacterial cytoplasm superfolder GFP with DogTag and flanking linkers between Asp102 and Asp103DepositorInsertsfGFP-DogTag Loop B
TagsHis6ExpressionBacterialMutationDogTag and linkers inserted between residues Asp1…PromoterT7Available SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28-sfGFP-SpyTag003 Loop A
Plasmid#171776PurposeExpresses in bacterial cytoplasm superfolder GFP with SpyTag003 and flanking linkers between Val22 and Asn23DepositorInsertsfGFP-SpyTag003 Loop A
TagsHis6ExpressionBacterialMutationSpyTag003 and linkers inserted between residues V…PromoterT7Available SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSUPER.retro.puro-shMePCE_shLARP7
Plasmid#113538PurposeRetroviral vector designed to knock down MePCE and LARP7 simultaneously.DepositorInsertshMePCE and shLARP7 (MEPCE Human)
UseRetroviralAvailable SinceJuly 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
PX458_NFIA_iso1_2
Plasmid#104049PurposeEncodes gRNA for 3' target of human NFIA_iso1 along with Cas9 with 2A GFPDepositorAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_NFIA_iso1_1
Plasmid#104048PurposeEncodes gRNA for 3' target of human NFIA_iso1 along with Cas9 with 2A GFPDepositorAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YOLCd1b
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSLQ3538 eforRed-targeting sgRNA
Plasmid#239455Purposeguide for eforRedDepositorInsertguide targeting eforRed
UseCRISPR; Cell-free system using bacterial extractExpressionBacterialPromoterJ23119Available SinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgBAK-1
Plasmid#210131Purposeknock out BAK in mammalian cellsDepositorInsertBcl-2 homologous antagonist/killer (BAK1 Human)
UseCRISPRAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgMETAP1_2
Plasmid#163463Purposelentiviral vector expressing Cas9 and an sgRNA targeting METAP1DepositorInsertsgRNA 2 targeting METAP1 (METAP1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GSG1l-GFP KI
Plasmid#131492PurposeEndogenous tagging of GSG1-l: C-terminal (amino acid position: STOP codon)DepositorAvailable SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -