We narrowed to 5,041 results for: U6...
-
Plasmid#73527PurposeExpresses a human codon-optimized SpCas9 and sgRNA targeting Dgcr8DepositorInsertDGCR8
UseCRISPRExpressionMammalianPromoterhU6Available SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-sgRNA_Dgcr8_4
Plasmid#73528PurposeExpresses a human codon-optimized SpCas9 and sgRNA targeting Dgcr8DepositorInsertDGCR8
UseCRISPRExpressionMammalianPromoterhU6Available SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-sgRNA_Dgcr8_2
Plasmid#73526PurposeExpresses a human codon-optimized SpCas9 and sgRNA targeting Dgcr8DepositorInsertDGCR8
UseCRISPRExpressionMammalianPromoterhU6Available SinceApril 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-PLCE1i2
Plasmid#59629PurposeExpression of shRNA against human PLCE1DepositorAvailable SinceOct. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-PTPRJi1
Plasmid#59608PurposeExpression of shRNA against human PTPRJDepositorAvailable SinceSept. 26, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-ADAM21i2
Plasmid#59605PurposeExpression of shRNA against human ADAM21DepositorAvailable SinceOct. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-for-dSERT
Plasmid#221830PurposePlasmid to express gRNA1 (cgaaatctgcgctctacttg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-for-dSERT
Plasmid#221831PurposePlasmid to express gRNA2 (gggattcgagcggcccgtcg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs-RMRP (pAVA3583)
Plasmid#239260PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting RMRPDepositorInsertU6-driven sgRNA1 and 7SK-driven sgRNA2 targeting RMRP
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs-RMRP (pAVA3584)
Plasmid#239261PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting RMRPDepositorInsertU6-driven sgRNA1 and 7SK-driven sgRNA2 targeting RMRP
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs-RPPH1 (pAVA3585)
Plasmid#239262PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting RPPH1DepositorInsertU6-driven sgRNA1 and 7SK-driven sgRNA2 targeting RPPH1
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459_LIG4_Exon3
Plasmid#225363PurposepX459 plasmid encoding the sgRNA protospacer sequence “5’-GCATAATGTCACTACAGATC-3’ to target the LIG4 gene.DepositorAvailable SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSG297-(Sp-gRNA)-(Sa-gRNA)-(PuroR_T2A_BFP(C>T screening))
Plasmid#239448PurposeOrthogonal dual Cas9 gRNA and BFP reporter lentivirus cassette plasmid. For use with S. pyogenes and S. aureus gRNAs and includes a BFP reporter which reports on C-to-T editing.DepositorInsertsS.p. gRNA backbone
S.a. gRNA backbone
PuroR-T2A-BFP(C>T_screening)
UseLentiviralExpressionMammalianMutationBFP: T65S, S72S, V145F, K206K, H231LPromoterEF1alpha, U6, and mU6Available SinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-BFP
Plasmid#227505PurposeBackbone for CARGO cloning, with U6 promoter and gRNA scaffold, TagBFP, and Kanamycin resistenceDepositorTypeEmpty backboneUseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458-PLK4
Plasmid#227310PurposeExpresses SpCas9 and a sgRNA targeting the C-terminus of PLK4 for knock-in.DepositorAvailable SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
gRNA_SRR124.5_tagBFP
Plasmid#163753PurposegRNA expression vector containing the tagBFP fluorescent marker to target the region upstream of the SRR124 SOX2 enhancer in human cells.DepositorInsertgRNA_SRR124.5
UseCRISPRTagstagBFPExpressionMammalianPromoterU6Available SinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
gRNA_SRR134.3_miRFP670
Plasmid#163754PurposegRNA expression vector containing the miRFP670 fluorescent marker to target the region downstream of the SRR134 SOX2 enhancer in human cells.DepositorInsertgRNA_SRR134.3
UseCRISPRTagsmiRFP670ExpressionMammalianPromoterU6Available SinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
BoxB-MS2 adRNA (RAB7A-GAC site)
Plasmid#170149PurposeAAV vector carrying a BoxB-MS2 adRNA targeting the RAB7A transcriptDepositorInsertBoxB-RAB7A(GAC)-MS2
UseAAVExpressionMammalianPromoterHuman U6Available SinceAug. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
SL3-MS2-gRNA GG backbone (MOBE3-4)
Plasmid#219949PurposeGolden gate backbone for mammalian expression of Sp-gRNA with SL3-MS2DepositorInsertgRNA-MS2-SL3 (S. pyogenes Cas9)
UseCRISPRExpressionMammalianPromoterU6Available SinceJuly 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
3'-com-gRNA GG backbone (MOBE1-4)
Plasmid#219947PurposeGolden gate backbone for mammalian expression of Sp-gRNA with 3'-comDepositorInsertgRNA-com-3'end (S. pyogenes Cas9)
UseCRISPRExpressionMammalianPromoterU6Available SinceJuly 30, 2024AvailabilityAcademic Institutions and Nonprofits only