We narrowed to 9,093 results for: sgRNA
-
Plasmid#247332PurposeVector encoding human codon-optimized engineered DelIscB nickase fusion with TadA8e driven by CAG promoter, optimized sgRNA (sgRNA-V5) driven by hU6, and mCherry driven by CMV promoterDepositorInsertpCAG_enDelIscB(D60A)-2×TadA8e(V106W)_npNLS_polyA_pU6_sgRNA_V5-BsaI_pCMV_mCherry
UseCRISPRExpressionMammalianAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
53BP1 N-terminal sgRNA
Plasmid#207091PurposepX330 based plasmid for expression of Cas9 and the GGGGAGCAGATGGACCCTAC sgRNA to target the 53BP1 locus.DepositorInsertGGGGAGCAGATGGACCCTAC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-NONO 40
Plasmid#127653PurposeKnock-out of human NONODepositorInsertNONO sgRNA (NONO Human)
UseLentiviralAvailable SinceJuly 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
Cdk13_intron3_sg4_pX458
Plasmid#127339PurposesgRNA that cuts within intron 3 of mouse CDK13 genomic locus- guide #4DepositorAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
psPAX2-D64V-NC-COM
Plasmid#131226PurposeExpressing GAG precursor protein, in which COM is inserted after the second zinc finger domain of nucleocapsid protein (NC)DepositorInsertCOM
UseLentiviralExpressionMammalianAvailable SinceOct. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
PB_rtTA_BsmB-XRN2_sgRNA_1
Plasmid#242895PurposePiggyBac cargo vector with XRN2 sgRNA 1 for dox-inducible knockdownDepositorAvailable SinceFeb. 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
LC3B sgRNA
Plasmid#207556PurposepX330 expressing Cas9 and a sgRNA targeting the LC3B locusDepositorInsertCACTGAATACCAGCGCCTAG
ExpressionMammalianPromoterCMV and U6Available SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
MDC1 KO sgRNA
Plasmid#207103PurposepX330 based plasmid for expression of Cas9 and the GGTGTAACGTGGAGCCAGTA sgRNA to target the MDC1 coding sequence.DepositorInsertGGTGTAACGTGGAGCCAGTA
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATG9A sgRNA
Plasmid#207557PurposepX330 expressing Cas9 and a sgRNA targeting the ATG9A locusDepositorInsertCACTGAATACCAGCGCCTAG
ExpressionMammalianPromoterCMV and U6Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
53BP1 KO sgRNA
Plasmid#207104PurposepX330 based plasmid for expression of Cas9 and the AGATTCTCAGCCTGAAAGCC sgRNA to target the 53BP1 coding sequence.DepositorInsertAGATTCTCAGCCTGAAAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
WIPI2 sgRNA
Plasmid#207554PurposepX330 expressing Cas9 and a sgRNA targeting the WIPI2 locusDepositorInsertCGCGCGCCCAGCCATGAACC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS159
Plasmid#122378PurposeCRISPRi plasmid for use in Candida albicans. Contains dCas9-Mxi1 and NEUT5L integration site and the sgRNA cloning site (SNR52 promoter, PacI sites, sgRNA tail)DepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceMay 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCB-2
Plasmid#210388PurposeAll-in-one cumate-based inducible CRISPRi plasmid for use in StreptomycesDepositorInsertsdCas9
CymR
sgRNA cassette
UseCRISPR; Integrative vector for use in streptomycesMutationBsaI-flanked RFP cassette inserted in place of sp…PromoterSP11 and SP30Available SinceJan. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEditC
Plasmid#207532PurposePlasmid for cytidine base editing; oriV(pRO1600/ColE1), xylS (cured of BsaI-sites), Pm→CBE:SpnCas9, PEM7→non-specific sgRNA; SmR/SpRDepositorInsertxylS (cured of BsaI-sites), Pm→CBE:SpnCas9, PEM7→non-specific sgRNA
UseCRISPR; Pseudomonas vectorAvailable SinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEditA-RY
Plasmid#207533PurposePlasmid for adenine base editing; oriV(pRO1600/ColE1), xylS (cured of BsaI-sites), Pm→ABE:SpRY, PEM7→non-specific sgRNA; SmR/SpRDepositorInsertxylS (cured of BsaI-sites), Pm→ABE:SpRY, PEM7→non-specific sgRNA
UseCRISPR; Pseudomonas vectorAvailable SinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEditC-RY
Plasmid#207534PurposePlasmid for cytidine base editing; oriV(pRO1600/ColE1), xylS (cured of BsaI-sites), Pm→CBE:SpRY, PEM7→non-specific sgRNA; SmR/SpRDepositorInsertxylS (cured of BsaI-sites), Pm→CBE:SpRY, PEM7→non-specific sgRNA
UseCRISPR; Pseudomonas vectorAvailable SinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti CRISPR V2 sgShmt2_1
Plasmid#106314PurposeExpress Cas9 and sgRNA targeting mShmt2DepositorAvailable SinceApril 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
U6-NT sgRNA; EF1a-dCas9-KRAB-GFP
Plasmid#194284PurposeEF1a-dCas9-KRAB-GFP with nontarget sgRNADepositorInsertdCas9-KRAB-GFP
UseCRISPR and LentiviralTagsGFPPromoterEF1aAvailable SinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pY2ShHELIX_sgRNA_entry (CJT30)
Plasmid#181781PurposeExpresses Y2-ShHELIX containing a nicking Y2 I-AniI fusion to ShTnsB. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertY2-nAniI-ShTnsB, ShTnsC, ShTniQ, ShCas12k
ExpressionBacterialMutationY2-nAniI = F13Y, S111Y, K227M, F80K, L232KPromoterLac and J23119Available SinceFeb. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-AsCpf1-2A-GFP-U6-sgRNA-cloning vector
Plasmid#159281PurposeA multicistronic vector with both CAGGS promoter-driven AsCpf1 and U6 promoter-driven single guide RNA (sgRNA)DepositorInsertAsCpf1-HA-2A-GFP
UseMulticistronic vector with both caggs promoter-dr…Tags3X HAExpressionMammalianPromoterU6Available SinceSept. 24, 2020AvailabilityAcademic Institutions and Nonprofits only