We narrowed to 9,195 results for: sgRNA
-
Plasmid#193979PurposeExpression of spCas9 and sgRNA targeting SIGIRRDepositorInsertspCas9 and sgRNA targeting SIGIRR (SIGIRR Human)
UseLentiviralAvailable SinceNov. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
p8271 LentiCRISPR v2 hygro sgSIGIRR-4
Plasmid#193980PurposeExpression of spCas9 and sgRNA targeting SIGIRRDepositorInsertspCas9 and sgRNA targeting SIGIRR (SIGIRR Human)
UseLentiviralAvailable SinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2 EGFP sgRNA4
Plasmid#164934PurposeExpresses EGFP sgRNA4 in mammalian cellsDepositorInsertsgRNA4 targeting Enhanced green fluorescent protein (verified for knockout)
UseLentiviralPromoterEFS promoterAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb HMEJ donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97308PurposeHMEJ donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb HMEJ donor
UseAAV and Mouse TargetingExpressionMammalianPromoterU6, EF1aAvailable SinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti_DualsgRNAEmptyVector_Puro_T2A_BFP2
Plasmid#236729PurposeDual sgRNA empty vector expressing BFP with Puromycin selectionDepositorTypeEmpty backboneUseLentiviralAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti_DualsgRNA_CTRL_Puro_T2A_BFP2
Plasmid#236730PurposeDual sgRNA targeting CTRL expressing BFP with Puromycin selectionDepositorInsertNegative CTRL
UseLentiviralAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFRT_TO_FLAGHA_PRKRA_sgRNA_PAM_mutant
Plasmid#106112PurposeInducible gene expression of FlagHA-PRKRA sgRNA PAM mutantDepositorInsertPRKRA (PRKRA Human)
TagsFlag and HAExpressionMammalianMutationsilent mutation of Gly32 (GGG-->GGT)Available SinceFeb. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_CELF1
Plasmid#106101PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting CELF1DepositorInsertgRNA targeting CELF1 (CELF1 Human)
UseCRISPRAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
L4440_BioBrick-hif-1-sgRNA-B
Plasmid#177785PurposeOverexpression of sgRNAs in E. coli HT115 (targeting C. elegans hif-1 promoter)DepositorInserthif-1 (hif-1 Nematode)
ExpressionBacterialAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
px330-UFM1 sgRNA2
Plasmid#134634Purposecontains sgRNA targeting human UFM1 for gene knockoutDepositorInsertUFM1 sgRNA2 (UFM1 Human)
ExpressionMammalianAvailable SinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
px330-UFM1 sgRNA1
Plasmid#134633Purposecontains sgRNA targeting human UFM1 for gene knockoutDepositorInsertUFM1 sgRNA1 (UFM1 Human)
ExpressionMammalianAvailable SinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX459_gRNA pAS dual_hspCas9
Plasmid#193312PurposeCas9 from S. pyogenes and U6-pAS dual sgRNA (V2.0)DepositorInsertCas9 from S. pyogenes and U6-pAS dual sgRNA (V2.0)
UseCRISPRExpressionMammalianMutationnot applicableAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSJX022
Plasmid#232325PurposeGenome editing in Caulobacter crescentusDepositorInsertssgRNA
SpCas9M
UseCRISPRTagsH-arms and catExpressionBacterialPromoterPJ23119 and PvanAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSJX016
Plasmid#232324PurposeGenome editing in Caulobacter crescentusDepositorInsertssgRNA
SpCas9M
UseCRISPRTagsH-arms and sfGFPExpressionBacterialPromoterPJ23119 and PvanAvailable SinceJune 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAbaMCi-GFP-gfp_pJMP2768
Plasmid#208889PurposeAcinetobacter baumannii CRISPRi test plasmid (GFP, gfp-targeting gRNA).DepositorInsertdCas9, sgRNA expression cassette, sfGFP
ExpressionBacterialAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJY-RpABE-FT_INF
Plasmid#112874Purposebinary vector for INF (Induced Neo-Functionalization) of FT in ArabidopsisDepositorInsertsRPS5A promoter
ABE7.10
U6-sgRNA targeting FT
UseCRISPRExpressionPlantAvailable SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
53BP1 N-terminal sgRNA
Plasmid#207091PurposepX330 based plasmid for expression of Cas9 and the GGGGAGCAGATGGACCCTAC sgRNA to target the 53BP1 locus.DepositorInsertGGGGAGCAGATGGACCCTAC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
Adeno BN
Plasmid#101823PurposeAdenovirus for the expression of gRNAs targeting intron 13 of murine Bcan and intron 10 of murine Ntrk1DepositorUseAdenoviralTagsFLAG-Cas9Available SinceNov. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJZC73
Plasmid#62341PurposesgRNA (no RNA aptamer addition) with COM-KRAB effector for mammalian cellsDepositorInsertssgRNA
COM-KRAB
UseLentiviralTagsKRABExpressionMammalianMutationTargets sv40 promoter, sequence: GAATAGCTCAGAGGCC…PromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
PXL
Plasmid#75349PurposePX330 derived. Bbs1 & annealed oligos to insert guide strand. BstB1+Pac1 of PXL and FUX-/pRubiX- T2A-Cas9 for choice of sgRNA, viral backbone, and fluorescent protein. Pac1 to introduce 2nd sgRNA.DepositorInsertCas9
UseCRISPRExpressionMammalianPromoterU6Available SinceMay 20, 2016AvailabilityAcademic Institutions and Nonprofits only