We narrowed to 8,876 results for: sgrna
-
Plasmid#230908PurposeDouble inducible expression of Cas12a+ with Gal4 and Flp.DepositorInsertCas12a+
UseCRISPRExpressionInsectAvailable SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458-PLK4
Plasmid#227310PurposeExpresses SpCas9 and a sgRNA targeting the C-terminus of PLK4 for knock-in.DepositorAvailable SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
p8270 LentiCRISPR v2 hygro sgSIGIRR-3
Plasmid#193979PurposeExpression of spCas9 and sgRNA targeting SIGIRRDepositorInsertspCas9 and sgRNA targeting SIGIRR (SIGIRR Human)
UseLentiviralAvailable SinceNov. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJMP8921
Plasmid#220903PurposeMobileCRiSPRi test system encoded on a kanR Tn7 transposon; mScarlet-I, PD-sgRNA (BsaI site), and PC-dCas9-novoDepositorInsertdCas9-novo
UseCRISPRTags3xMycExpressionBacterialMutationD10A, H840AAvailable SinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJMP8932
Plasmid#220906PurposeMobileCRiSPRi system encoded on a kanR Tn7 transposon; PD-sgRNA (BsaI site) and PG-dCas9-novo (for cloning new guides)DepositorInsertdCas9-novo
UseCRISPRTags3xMycExpressionBacterialMutationD10A, H840AAvailable SinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
hLig4 guide2 in pX458
Plasmid#211536PurposesgRNA-2 against Lig4DepositorAvailable SinceJan. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
hLig4 guide1 in pX458
Plasmid#211535PurposesgRNA-1 against Lig4DepositorAvailable SinceJan. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pENTR-TC9
Plasmid#202088Purposeentry vector for gateway recombination of TevCas9 and sgRNA into a destination cassette in pCitro-destDepositorInsertTevCas9 + sgRNA cassette
UseCRISPRAvailable SinceJune 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
p8271 LentiCRISPR v2 hygro sgSIGIRR-4
Plasmid#193980PurposeExpression of spCas9 and sgRNA targeting SIGIRRDepositorInsertspCas9 and sgRNA targeting SIGIRR (SIGIRR Human)
UseLentiviralAvailable SinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG1
Plasmid#188967PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtggaaaacaatgcgaccgactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG2
Plasmid#188968PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
PHY55-mouse U6-sgLMNA
Plasmid#164045PurposeU6-driven sgRNA targeting LMNADepositorInsertLMNA targeting sgRNA
UseCRISPRPromotermouse U6Available SinceApril 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJJF449_dpy-10_CDS_sg1
Plasmid#163866PurposesgRNA targeting dpy-10 (CDS) in C. elegans. Backbone: pJJR50.DepositorInsertsgRNA targeting the coding sequence of dpy-10
UseCRISPRExpressionWormPromoterR07E5.16 (U6)Available SinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJJF328_sqt-3_3′UTR_sg2
Plasmid#163867PurposesgRNA targeting sqt-3 (3′UTR) in C. elegans. Backbone: pJJR50.DepositorInsertsgRNA targeting the 3'UTR of sqt-3
UseCRISPRExpressionWormPromoterR07E5.16 (U6)Available SinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJJF496_dpy-10_CDS_sg6
Plasmid#164267PurposesgRNA targeting dpy-10 (CDS) in C. elegans. Backbone: pJJR50.DepositorInsertsgRNA targeting the coding sequence of dpy-10
UseCRISPRExpressionWormPromoterR07E5.16 (U6)Available SinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJJF495_dpy-10_CDS_sg6
Plasmid#164268PurposesgRNA targeting dpy-10 (CDS) in C. elegans. Backbone: pJJF439.DepositorInsertsgRNA targeting the coding sequence of dpy-10
UseCRISPRExpressionWormPromoterU6 promoter from W05B2.8Available SinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGuide-P1-O1a (EL702)
Plasmid#140040PurposeCRISPR DuMPLING negative control plasmid with probe/barcode P1 and negative control lacO1array spacer in the sgRNA. Also template for library PCRs.DepositorInsertbarcode P1 and sgRNA lacO1 array
UseSynthetic BiologyAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUC19-hsg(NT:NT)
Plasmid#138260PurposeExpression of a non-targeting sgRNA to the left and right of iCas9 recognition site to be used as a control in Traffic Light reporter systemDepositorInsertNontargeting sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
sgPYM1
Plasmid#105249Purposehuman PYM1 sgRNADepositorInsertsgRNA for PYM1
ExpressionMammalianAvailable SinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJKW0457
Plasmid#107586PurposeAtU6-26 sgRNADepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterAtU6-26Available SinceApril 12, 2018AvailabilityAcademic Institutions and Nonprofits only