We narrowed to 6,257 results for: tTA
-
Plasmid#184978PurposeTest effect of extending a1/a2 on LYP1 editing rates in yeastDepositorInsertEco1 editing ncRNA and gRNA, LYP1 E27X, a1/a2 length: 27 v1
ExpressionYeastMutationLYP1 donor E27stop, a1/a2 length extended to 27 bpPromoterGal7Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.111
Plasmid#184980PurposeTest effect of extending a1/a2 on TRP2 editing rates in yeastDepositorInsertEco1 editing ncRNA and gRNA, TRP2 E64X, a1/a2 length: 27 v1
ExpressionYeastMutationTRP2 donor E64stop, a1/a2 length extended to 27 bpPromoterGal7Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.037
Plasmid#184966PurposeExpress -Eco1 dead RT and ncRNA in yeasstDepositorInsertEco1: RT and ncRNA(wt), a1/a2 length: 12, dead RT
ExpressionYeastMutationHuman codon optimized RT, YXDD catalytic region m…PromoterGal7Available SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.112
Plasmid#184981PurposeExpress -Eco1 FAA1 editing ncRNA and gRNADepositorInsertEco1 editing ncRNA and gRNA, FAA1 P233X, a1/a2 length: 12
ExpressionYeastMutationFAA1 donor P233stopPromoterGal7Available SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.113
Plasmid#184982PurposeTest effect of extending a1/a2 on FAA1 editing rates in yeastDepositorInsertEco1 editing ncRNA and gRNA, FAA1 P233X, a1/a2 length: 27 v1
ExpressionYeastMutationFAA1 donor P233stop, a1/a2 length extended to 27 …PromoterGal7Available SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.110
Plasmid#184979PurposeExpress -Eco1 TRP2 editing ncRNA and gRNADepositorInsertEco1 editing ncRNA and gRNA, TRP2 E64X, a1/a2 length: 12
ExpressionYeastMutationTRP2 donor E64stopPromoterGal7Available SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2
Plasmid#188964PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS2+WBP2NL-HA
Plasmid#174791PurposeXenopus laevis WBP2NL with 3'HA tagDepositorInsertWBP2 N-terminal like (wbp2nl.L Frog)
TagsHAExpressionBacterialMutationaa#165, Y to H; aa# 287, D to HPromoterSP6Available SinceDec. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCS2+-wbp2nl
Plasmid#172463Purposeexpresses wild-type protein when injected into embryosDepositorAvailable SinceSept. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMB204: UbC-GFP-Tg_SAP30L-WPRE
Plasmid#168109PurposeLentiviral expression of Zebra Finch SAP30L fused to the C-terminal end of eGFPDepositorAvailable SinceMay 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMRBad-Z-C-DiB-RM
Plasmid#168477PurposeC-fragment of the DiB-RM‐split‐Zip protein. This plasmid needs to be co-transformed with Plasmid 168475: pET11a-Z-N-DiB-RM to obtain DiB-RM‐split-Zip proteinDepositorInsertLeucine Zipper + C-fragment of DiB-RM
ExpressionBacterialPromoteraraBADAvailable SinceMay 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET11a-Z-N-DiB-RM
Plasmid#168475PurposeN-fragment of the DiB-RM‐split‐Zip protein. This plasmid needs to be co-transformed with Plasmid 168477: pMRBad-Z-C-DiB-RM to obtain DiB-RM‐split-Zip proteinDepositorInsertN-fragment of DiB-RM + Leucine Zipper
TagsHis-tagExpressionBacterialPromoterT7Available SinceMay 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHA841 - hrp-1p::hrp-1HsLCWT
Plasmid#139198PurposeExpresses hrp-1p::hrp-1HsLCWT::hrp-1 3'UTRDepositorInserthrp-1 (hrp-1 Nematode)
ExpressionWormMutationlast exon replaced with correspoding human sequen…Available SinceDec. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHA842 - hrp-1p::hrp-1HsLCD290V
Plasmid#139199PurposeExpresses hrp-1p::hrp-1HsLCD290V::hrp-1 3'UTRDepositorInserthrp-1 (hrp-1 Nematode)
ExpressionWormMutationD290V, last exon replaced with correspoding human…Available SinceDec. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHA848 - mec-4p::hrp-1HsLCWTmScarlet
Plasmid#139202PurposeExpresses mScarlet tagged hrp-1HsLCWT in mec-4 neuronsDepositorInserthrp-1 (hrp-1 Nematode)
ExpressionWormMutationmScarlet added between RRMs and LC, last exon rep…Available SinceDec. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHA849 - mec-4p::hrp-1HsLCD290VmScarlet
Plasmid#139203PurposeExpresses mScarlet tagged hrp-1HsLCD290V in mec-4 neuronsDepositorInserthrp-1 (hrp-1 Nematode)
ExpressionWormMutationmScarlet added between RRMs and LC, D290V, last e…Available SinceDec. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHA845 - hrp-1p::hrp-1HsLCWTmScarlet
Plasmid#139205PurposeExpresses mScarlet tagged hrp-1HsLCWTDepositorInserthrp-1 (hrp-1 Nematode)
ExpressionWormMutationmScarlet added between RRMs and LC, last exon rep…Available SinceDec. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHA846 - hrp-1p::hrp-1HsLCD290VmScarlet
Plasmid#139206PurposeExpresses mScarlet tagged hrp-1HsLCD290VDepositorInserthrp-1 (hrp-1 Nematode)
ExpressionWormMutationmScarlet added between RRMs and LC, D290V, last e…Available SinceDec. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
hnRNPF_PLD
Plasmid#139113Purposeexpress prion like domain of hnRNPFDepositorAvailable SinceDec. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S(-10TC)_Psyn-sgRNAftsI
Plasmid#149591Purposeall-in-all CRISPRi vector for targeting B. burgdorferi ftsIDepositorInsertdCas9, lacI, sgRNAftsI
UseCRISPRExpressionBacterialPromoterPflaB, PpQE30(-10TC), PsynAvailable SinceNov. 24, 2020AvailabilityAcademic Institutions and Nonprofits only