We narrowed to 165,918 results for: addgene
-
Plasmid#225052PurposeExpress in mammalian cells the mRFP1 fused to residues 1-261 of Human Utrophin to detect filamentous actin in live, fix cels or tissues.DepositorInsertHuman Utrophin residues 1-261 and RFP1 (UTRN Human, Homo Sapiens)
UseLentiviralTagsHuman UTROPHIN 1-261 and mRFP1ExpressionMammalianMutationSequence is derived from ADDGENE Plasmid #26739-R…PromoterCMV promoter and enhancerAvailable SinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-EGFP-Human-UTROPHIN_1-261
Plasmid#222393PurposeExpress in mammalian cells the EGFP fused to residues 1-261 of Human Utrophin to detect filamentous actin in live, fix cels or tissues.DepositorInsertHuman Utrophin residues 1-261 and EGFP (UTRN Human, Homo Sapiens)
UseLentiviralTagsEGFP and Human UTROPHIN 1-261ExpressionMammalianMutationSequence is derived from ADDGENE Plasmid #26737-G…PromoterCMV promoter and enhancerAvailable SinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDC1 KO sgRNA
Plasmid#207103PurposepX330 based plasmid for expression of Cas9 and the GGTGTAACGTGGAGCCAGTA sgRNA to target the MDC1 coding sequence.DepositorInsertGGTGTAACGTGGAGCCAGTA
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-PGK-CXCR4 (neo)
Plasmid#192077PurposeLentivirus for expression of CXCR4DepositorAvailable SinceDec. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEF-I-GFP GX
Plasmid#45443DepositorTypeEmpty backboneTagsIRES EGFPExpressionMammalianPromoterhuman EF1αAvailable SinceJuly 2, 2013AvailabilityAcademic Institutions and Nonprofits only -
p8267 LentiCRISPR v2 hygro sgNT-2
Plasmid#193978PurposeExpression of spCas9 and non-targeting control sgRNADepositorInsertspCas9
UseLentiviralAvailable SinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLVPRT-tTR-KRAB
Plasmid#11648PurposeTet-regulated (Tet-on) lentiviral vector for transgene (hPrion promoter) - OR - shRNA (H1 promoter when subcloned from pLVTHM (Addgene#12247)) - 2nd generationDepositorInserthPrion, GFP, tTR-KRAB, Tet-on
UseLentiviralExpressionMammalianAvailable SinceAug. 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-NED
Plasmid#109358PurposeMammalian vector for expressing effector domains fused to dCas9.DepositorTypeEmpty backboneUseCRISPRTagsdCas9, SV40 NLS, 3xFLAGExpressionMammalianPromoterCMVAvailable SinceMay 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX459_gRNA-AAVS1_hspCas9
Plasmid#193309PurposeCas9 from S. pyogenes and U6 AAVS1 sgRNA (V2.0)DepositorInsertCas9 from S. pyogenes and U6 AAVS1 sgRNA (V2.0)
UseCRISPRExpressionMammalianMutationnot applicableAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CarO-BFP2-TSERex
Plasmid#124795PurposeExpresses the proton pump rhodopsin in mammalian cells under CAG promoterDepositorInsertCarO-BFP2
ExpressionMammalianPromoterCAGAvailable SinceMay 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Mac-BFP2-TSERex
Plasmid#124793PurposeExpresses the proton pump rhodopsin in mammalian cells under CAG promoterDepositorInsertMac-BFP2
ExpressionMammalianPromoterCAGAvailable SinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs N-terminal sgRNA
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorInsertAGCGGGACTCGGCGGCATGG
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
7TG
Plasmid#24314DepositorInsert7xTcf-eGFP
UseLentiviralMutationEGFP is GFP with S65T and F64L mutationsAvailable SinceApril 5, 2010AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-Stuffer-HepmCherry
Plasmid#192825PurposeContains stuffer sequence into which sgRNAs can be cloned and expresses mCherry from hepatocyte-specific promoterDepositorInsertmCherry
UseCRISPR and LentiviralExpressionMammalianPromoterHepatocyte-specific promoter (HS-CRM8-TTRmin modu…Available SinceNov. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti UBC hNLRP3-mNG
Plasmid#218642PurposeExpresses NLRP3 tagged with mNeonGreen in mammalian cells (lentiviral); driven by the weak UBC promoter with puro selectionDepositorAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
ULK1 sgRNA
Plasmid#207559PurposepX330 expressing Cas9 and a sgRNA targeting the ULK1 locusDepositorInsertCCAGCCAGGCCAGAAAGGTC
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLVPT-rtTR-KRAB
Plasmid#11777PurposeTet-regulated (Tet-off) lentiviral vector for transgene (mPGK promoter) - AND/OR - shRNA (H1 promoter when subcloned from pLVTHM (Addgene#12247)) - 2nd generationDepositorInsertmPGK, GFP, rtTR-KRAB, Tet-off
UseLentiviralExpressionMammalianAvailable SinceAug. 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
pSNAPf-Nup43
Plasmid#98276Purposemammalian expression of SNAPf-Nup43DepositorAvailable SinceJuly 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
6BHD (SETDB1)
Plasmid#119955PurposeBacterial expression for structure determinationDepositorInsertSETDB1 (SETDB1 Human)
Tags6xHis-TEVExpressionBacterialMutationcontains amino acids 190-410PromoterT7Available SinceFeb. 1, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
ATG9A sgRNA
Plasmid#207557PurposepX330 expressing Cas9 and a sgRNA targeting the ATG9A locusDepositorInsertCACTGAATACCAGCGCCTAG
ExpressionMammalianPromoterCMV and U6Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only