We narrowed to 1,431 results for: abo.1
-
Plasmid#191297PurposeBacterial co-expression of E. coli folA (Dihydrofolate Reductase) and E. coli thyA (Thymidylate Synthase)DepositorInsertfolA, thyA
ExpressionBacterialMutationG121V DHFR, R166Q TYMSPromoterT7 (folA), Tet (thyA)Available SinceJune 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTETDuet_F31YG121VDHFR_R166QTS
Plasmid#191299PurposeBacterial co-expression of E. coli folA (Dihydrofolate Reductase) and E. coli thyA (Thymidylate Synthase)DepositorInsertfolA, thyA
ExpressionBacterialMutationF31Y/G121V DHFR, R166Q TYMSPromoterT7 (folA), Tet (thyA)Available SinceJune 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTETDuet_WTDHFR_R127ATS
Plasmid#191300PurposeBacterial co-expression of E. coli folA (Dihydrofolate Reductase) and E. coli thyA (Thymidylate Synthase)DepositorInsertfolA, thyA
ExpressionBacterialMutationWT DHFR, R127A TYMSPromoterT7 (folA), Tet (thyA)Available SinceJune 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTETDuet_D27NDHFR_R127ATS
Plasmid#191301PurposeBacterial co-expression of E. coli folA (Dihydrofolate Reductase) and E. coli thyA (Thymidylate Synthase)DepositorInsertfolA, thyA
ExpressionBacterialMutationD27N DHFR, R127A TYMSPromoterT7 (folA), Tet (thyA)Available SinceJune 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTETDuet_M42FDHFR_R127ATS
Plasmid#191302PurposeBacterial co-expression of E. coli folA (Dihydrofolate Reductase) and E. coli thyA (Thymidylate Synthase)DepositorInsertfolA, thyA
ExpressionBacterialMutationM42F DHFR, R127A TYMSPromoterT7 (folA), Tet (thyA)Available SinceJune 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTETDuet_G121VDHFR_R127ATS
Plasmid#191303PurposeBacterial co-expression of E. coli folA (Dihydrofolate Reductase) and E. coli thyA (Thymidylate Synthase)DepositorInsertfolA, thyA
ExpressionBacterialMutationG121V DHFR, R127A TYMSPromoterT7 (folA), Tet (thyA)Available SinceJune 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTETDuet_F31YG121VDHFR_R127ATS
Plasmid#191304PurposeBacterial co-expression of E. coli folA (Dihydrofolate Reductase) and E. coli thyA (Thymidylate Synthase)DepositorInsertfolA, thyA
ExpressionBacterialMutationF31Y/G121V DHFR, R127A TYMSPromoterT7 (folA), Tet (thyA)Available SinceJune 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTETDuet_M42FG121VDHFR_R127ATS
Plasmid#191305PurposeBacterial co-expression of E. coli folA (Dihydrofolate Reductase) and E. coli thyA (Thymidylate Synthase)DepositorInsertfolA, thyA
ExpressionBacterialMutationM42F/G121V DHFR, R127A TYMSPromoterT7 (folA), Tet (thyA)Available SinceJune 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTETDuet_D27NDHFR_WTTS
Plasmid#191283PurposeBacterial co-expression of E. coli folA (Dihydrofolate Reductase) and E. coli thyA (Thymidylate Synthase)DepositorInsertfolA, thyA
ExpressionBacterialMutationD27N DHFR, WT TYMSPromoterT7 (folA), Tet (thyA)Available SinceJune 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTETDuet_M42FDHFR_WTTS
Plasmid#191284PurposeBacterial co-expression of E. coli folA (Dihydrofolate Reductase) and E. coli thyA (Thymidylate Synthase)DepositorInsertfolA, thyA
ExpressionBacterialMutationM42F DHFR, WT TYMSPromoterT7 (folA), Tet (thyA)Available SinceJune 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTETDuet_G121VDHFR_WTTS
Plasmid#191285PurposeBacterial co-expression of E. coli folA (Dihydrofolate Reductase) and E. coli thyA (Thymidylate Synthase)DepositorInsertfolA, thyA
ExpressionBacterialMutationG121V DHFR, WT TYMSPromoterT7 (folA), Tet (thyA)Available SinceJune 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTETDuet_M42FG121VDHFR_WTTS
Plasmid#191286PurposeBacterial co-expression of E. coli folA (Dihydrofolate Reductase) and E. coli thyA (Thymidylate Synthase)DepositorInsertfolA, thyA
ExpressionBacterialMutationM42F/G121V DHFR, WT TYMSPromoterT7 (folA), Tet (thyA)Available SinceJune 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTETDuet_F31YG121VDHFR_WTTS
Plasmid#191287PurposeBacterial co-expression of E. coli folA (Dihydrofolate Reductase) and E. coli thyA (Thymidylate Synthase)DepositorInsertfolA, thyA
ExpressionBacterialMutationF31Y/G121V DHFR, WT TYMSPromoterT7 (folA), Tet (thyA)Available SinceJune 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTETDuet_WTDHFR_Q33STS
Plasmid#191288PurposeBacterial co-expression of E. coli folA (Dihydrofolate Reductase) and E. coli thyA (Thymidylate Synthase)DepositorInsertfolA, thyA
ExpressionBacterialMutationWT DHFR, Q33S TYMSPromoterT7 (folA), Tet (thyA)Available SinceJune 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTETDuet_M42FDHFR_Q33STS
Plasmid#191290PurposeBacterial co-expression of E. coli folA (Dihydrofolate Reductase) and E. coli thyA (Thymidylate Synthase)DepositorInsertfolA, thyA
ExpressionBacterialMutationM42F DHFR, Q33S TYMSPromoterT7 (folA), Tet (thyA)Available SinceJune 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTETDuet_G121VDHFR_Q33STS
Plasmid#191291PurposeBacterial co-expression of E. coli folA (Dihydrofolate Reductase) and E. coli thyA (Thymidylate Synthase)DepositorInsertfolA, thyA
ExpressionBacterialMutationG121V DHFR, Q33S TYMSPromoterT7 (folA), Tet (thyA)Available SinceJune 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDEW8
Plasmid#84238PurposePlasmid containing a P2A peptide (porcine teschovirus-1 derived) sequence that works efficiently in Saccharomyces cerevisiaeDepositorInsertHA-mRuby-P2A-eGFP
TagsHA-mRuby and eGFPExpressionYeastPromoterGPDAvailable SinceNov. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET29b-pld
Plasmid#128795Purposeexpresses E. coli PLD in bacteriaDepositorInsertPhospholipase D
TagsHis6ExpressionBacterialPromoterT7Available SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGCā¦Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKL06
Plasmid#104430Purposesuper Ecliptic pHluorin with C terminal mRuby2 fusion tag in yeast expression vectorDepositorInsertSuper Ecliptic pHluorin-mRuby2
ExpressionYeastPromoterTef1Available SinceJune 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSR357.12
Plasmid#125107PurposeExpression of narL(1-134aa)-ydfI(129-213aa) chimera under PLtetO-1, output Promoter PydfJ115DepositorInsertsnarL(REC)-ydfI(DBD)134
sfgfp
tetR
UseSynthetic BiologyExpressionBacterialMutationA84T - see depositor comments below and Q183K-seeā¦Available SinceJune 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAG416GALL-HIV-1_PR
Plasmid#203493PurposeExpresses HIV-1 protease from a GALL promoter with a URA3 markerDepositorInsertHIV-1 protease
ExpressionYeastPromoterGALLAvailable SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET19b_4CL:P3S
Plasmid#139796Purposeexpression of biosynthetic enzyme 4CL in fusion with CC segment P3SDepositorInsert4CL:P3S
ExpressionBacterialAvailable SinceJune 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET19b_STS:P4S
Plasmid#139797Purposeexpression of biosynthetic enzyme STS in fusion with CC segment P4SDepositorInsertSTS:P4S
ExpressionBacterialAvailable SinceJune 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET19b_4CL:STS (DF)
Plasmid#139791Purposedirect fusion of biosynthetic enzymes 4CL and STSDepositorInsertdirect fusion of 4CL and STS
ExpressionBacterialAvailable SinceJune 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKIKOarsBCm
Plasmid#46763PurposeE.coli genomic integration at arsBDepositorTypeEmpty backboneUseE.coli genomic integrationAvailable SinceSept. 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pKIKOarsBKm
Plasmid#46766PurposeE.coli genomic integration at arsBDepositorTypeEmpty backboneUseE.coli genomic integrationAvailable SinceOct. 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
pKIKOlacZCm
Plasmid#46764PurposeE.coli genomic integration at lacZDepositorTypeEmpty backboneUseE.coli genomic integrationAvailable SinceSept. 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pKIKOlacZKm
Plasmid#46767PurposeE.coli genomic integration at lacZDepositorTypeEmpty backboneUseE.coli genomic integrationAvailable SinceSept. 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
pKIKOrbsARCm
Plasmid#46765PurposeE.coli genomic integration rbsAR locusDepositorTypeEmpty backboneUseE.coli genomic integrationAvailable SinceSept. 23, 2013AvailabilityAcademic Institutions and Nonprofits only