We narrowed to 6,006 results for: pCas
-
Plasmid#188101PurposeExpresses human ATG13 HORMA Y118D mutant in mammalian cellsDepositorInsertATG13 (ATG13 Human)
Tagsstrep-strep-Flag tagExpressionMammalianMutationATG13 (2-197)-Y118DPromoterCMVAvailable SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-OSF-ATG13 (2-197)-E83L
Plasmid#188099PurposeExpresses human ATG13 HORMA E83L mutant in mammalian cellsDepositorInsertATG13 (ATG13 Human)
Tagsstrep-strep-Flag tagExpressionMammalianMutationATG13 (2-197)-E83LPromoterCMVAvailable SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-OSF-ATG13 (2-197)-Y115D
Plasmid#188100PurposeExpresses human ATG13 HORMA Y115D mutant in mammalian cellsDepositorInsertATG13 (ATG13 Human)
Tagsstrep-strep-Flag tagExpressionMammalianMutationATG13 (2-197)-Y115DPromoterCMVAvailable SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-OSF-ATG13 (2-197)-F19D
Plasmid#188097PurposeExpresses human ATG13 HORMA F19D mutant in mammalian cellsDepositorInsertATG13 (ATG13 Human)
Tagsstrep-strep-Flag tagExpressionMammalianMutationATG13 (2-197)-F19DPromoterCMVAvailable SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-GST-ATG101-W110D/F112D
Plasmid#188106PurposeExpresses human ATG101 HORMA W110D/F112D mutant in mammalian cellsDepositorInsertATG101 (ATG101 Human)
TagsGST tagExpressionMammalianMutationcodon-optimized ATG101-W110D/F112DPromoterCMVAvailable SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-OSF-ATG13 (2-197)-L151D
Plasmid#188102PurposeExpresses human ATG13 HORMA L151D mutant in mammalian cellsDepositorInsertATG13 (ATG13 Human)
Tagsstrep-strep-Flag tagExpressionMammalianMutationATG13 (2-197)-L151DPromoterCMVAvailable SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-chGrb2/eDHFR(69K6)-iRFP713
Plasmid#178854PurposeMammalian expression of Grb2-eDHFR(69K6) chimera fused to iRFP713DepositorInsertGrb2(1-59)-eDHFR(69K6)-Grb2(152-216)-iRFP713 (GRB2 Human)
ExpressionMammalianMutationGrb2: Y160EPromoterCAGAvailable SinceJuly 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-chPKCdelta/eDHFR(69K6)-EGFP
Plasmid#178857PurposeMammalian expression of PKCδ-eDHFR(69K6) chimera fused to EGFPDepositorAvailable SinceJuly 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-chPKCdelta/eDHFR(69K6)-miRFP670
Plasmid#178858PurposeMammalian expression of PKCδ-eDHFR(69K6) chimera fused to miRFP670DepositorInsertPKCδ(1-229)-eDHFR(69K6)-PKCδ(280-675)-miRFP670 (PRKCD Human)
ExpressionMammalianPromoterCAGAvailable SinceJuly 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJCC_162 SpCas9 KES(1107-1109)GG
Plasmid#179526PurposeFor bacterial expression of SpCas9 KES(1107-1109)GG (phosphate lock loop mutant) with an N-terminal His-MBP tagDepositorInsertSpCas9 KES(1107-1109)GG
Tags10X His, TEV protease cleavage site, and maltose-…ExpressionBacterialMutationreplaced KES (residues 1107-1109) with GGAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-3exo-Tetra-com-CLCN5-sp-g1
Plasmid#176236PurposePlasmid for expressing a fusion protein of spCas9 and the 3’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
ExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-5Exo-tetra-com-hCLCN5-sp-g1
Plasmid#176237PurposePlasmid for expressing a fusion protein of spCas9 and the 5’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
ExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-Exo-tetra-com-hCLCN5-sp-g1
Plasmid#176238PurposePlasmid for expressing a fusion protein of spCas9 and the 5’ and 3’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
ExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG1.1-Armc12 delta ARM/FLAG
Plasmid#180496PurposeExpression vector of ARM domain deleted mouse Armc12 tagged with FLAG at C-terminus. See Fig.4D of Shimada, K. et al. Proc. Natl. Acad. Sci. USA. 118 (6): e2018355118, 2021.DepositorInsertarmadillo repeat containing 12 (Armc12 Mouse)
TagsFLAG tagExpressionMammalianMutationARM domain of Armc12 is deletedPromoterCAG promoterAvailable SinceMarch 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-Puro (PX462) V2.0 Stx5DL-B2
Plasmid#165083PurposegRNA 2 of pair B for Stx5L-specific knockoutDepositorInserthSpCas9n-2A-Puro
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterCMVAvailable SinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-Puro (PX462) V2.0 Stx5DL-C1
Plasmid#165085PurposegRNA 1 of pair C for Stx5L-specific knockoutDepositorInserthSpCas9n-2A-Puro
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterCMVAvailable SinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-Puro (PX462) V2.0 Stx5DL-C2
Plasmid#165086PurposegRNA 2 of pair C for Stx5L-specific knockoutDepositorInserthSpCas9n-2A-Puro
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterCMVAvailable SinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-mcherry-WIPI2dH85E-cs-TEV-STREP
Plasmid#171838PurposeMammalian expression of human WIPI2d H85E with N-terminal mCherry and C-terminal StrepDepositorAvailable SinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only