We narrowed to 3,133 results for: ER;
-
Plasmid#184557PurposeKnockdown of murine KRAS gene by targeting the promoter region via CRISPRi systemDepositorInsertKirsten rat sarcoma virus (Kras Mouse)
UseCRISPR, Lentiviral, and Mouse TargetingTagsFlagExpressionBacterialMutationPromoterAvailable sinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralTagsExpressionMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…PromoterAvailable sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralTagsExpressionMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…PromoterAvailable sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralTagsExpressionMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…PromoterAvailable sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
mCherry-PTDSS1-IRES-puromycin-pLVx-EF1a
Plasmid#177435PurposeTo express mCherry fused to PTDSS1, a protein that localized to mitochondria associated ER membranes (MAMs). Lentiviral vector used to make cell lines expressing this MAM landmark.DepositorInsertPhosphatidylserine synthase-1, PTDSS1, LMHD, PSS1, PSSA (PTDSS1 Human)
UseLentiviralTagsmCherryExpressionMammalianMutationPromoterEF1aAvailable sinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
mCerulean3-BclXL-Cb5-pEGFP-C1
Plasmid#177414PurposeTo express mCerulean3 fused to the N-terminus of the Bcl-2 family chimera protein, Bcl-XL-Cb5: Bcl-XL with its membrane binding region swapped for Cb5 (ER targeting sequence).DepositorInsertBcl-XL-Cb5, BclX-cb5
UseTagsmCerulean3ExpressionMammalianMutationPromoterCMVAvailable sinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
Venus-Bcl2-cb5-pEGFP-C1
Plasmid#177422PurposeTo express Venus fused to the N-terminus of the Bcl-2 family chimera protein, Bcl-2-Cb5: Bcl-2 with its membrane binding region swapped for Cb5 (ER targeting sequence).DepositorInsertBcl-2-Cb5, Bcl2-cb5, Bcl-cb5
UseTagsVenusExpressionMammalianMutationPromoterCMVAvailable sinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
mCerulean3-Bcl2-cb5-s2193
Plasmid#177423PurposeTo express mCerulean3 fused to the N-terminus of the Bcl-2 family chimera protein, Bcl-2-Cb5: Bcl-2 with its membrane binding region swapped for Cb5 (ER targeting sequence).DepositorInsertBcl-2-Cb5, Bcl2-cb5, Bcl-cb5
UseTagsmCerulean3ExpressionMammalianMutationPromoterHuman ferritinAvailable sinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
GFP-HDEL
Plasmid#129098PurposeFor labeling endoplasmic reticulum (ER) in S. cerevisiae with GFP-HDELDepositorInsertTEF1p-SS-3xGlyAla-GFP-HDEL
UseTagsExpressionYeastMutationPromoterAvailable sinceJuly 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV Syn 2xLyn-ERex-mKate2-bPAC(F198Y)
Plasmid#219654PurposeNeuronal expression of PACmn with mKate2, a membrane targeted version of the photoactivatable adenylyl cyclase from Beggiatoa with lowered dark activity.DepositorInsert2xLyn-ERex-mKate2-bPAC(F198Y)
UseAAVTagsER exit ( FCYENE) and Lyn11 (GCIKSKGKDS)ExpressionMammalianMutationPromoterSynAvailable sinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pESR1-donor
Plasmid#112337PurposeCRISPR donor plasmid to tag human transcription factor ESR1 with GFPDepositorInsertESR1 homology arms flanking EGFP-IRES-Neo cassette (ESR1 Human)
UseCRISPRTagsExpressionMutationUnknownPromoterAvailable sinceApril 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pESR1.1.0-gDNA
Plasmid#112433PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ESR1DepositorInsertESR1 (ESR1 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
mCherry-7aa-cb5-pEGFP-C1
Plasmid#177407PurposeTo express mCherry fused to endoplasmic reticulum (ER) targeting sequence "Cb5". mCherry faces the cytosol.DepositorInsertCb5 tail anchor (Cyb5r4 Rat)
UseTagsmCherryExpressionMammalianMutationPromoterCMVAvailable sinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
mCerulean3-Bcl2-cb5-pEGFP-C1
Plasmid#177421PurposeExpress mCerulean3 fused to the N-terminus of the Bcl-2 family chimera protein, Bcl-2-Cb5: Bcl-2 with its membrane binding region swapped for Cb5 (ER targeting sequence).DepositorInsertBcl-2-Cb5, Bcl2-cb5, Bcl-cb5
UseTagsmCerulean3ExpressionMammalianMutationPromoterCMVAvailable sinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGP-pcDNA3.1 Puro-CAG-Voltron2
Plasmid#172909PurposeMammalian expression of voltage sensorDepositorInsertVoltron2
UseTagsExpressionMammalianMutationA122DPromoterCAGAvailable sinceNov. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28a-AlkB
Plasmid#228218PurposeExpress wild type AlkB protein in E. coli BL21(DE3)DepositorInsertAlpha-ketoglutarate-dependent Dioxygenase (alkB Synthetic)
UseTagsHis tagExpressionBacterialMutationcodon optimizedPromoterT7Available sinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQ-Elo-HB-C-A(1-630)
Plasmid#171086PurposeCo-expresses of ΔC-ELOA containing Elongin complex in bacteria. The resulting plasmid was used to generate a single expression construct encoding all 3Elongin subunits, with a 6-His tag on ELOBDepositorUseTagsHisExpressionBacterialMutationDeleted N-term 26aa and C-term 142aa for mutant e…PromoterT5 promoterAvailable sinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pQ-Elo-HB-C-A(400-772)
Plasmid#171087PurposeCo-expresses of ΔN-ELOA containing Elongin complex in bacteria. The resulting plasmid was used to generate a single expression construct encoding all 3Elongin subunits, with a 6-His tag on ELOBDepositorUseTagsHisExpressionBacterialMutationDeleted N-term 26+399 amino acids for mutant expr…PromoterT5 promoter and T7 promoterAvailable sinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pQ-Elo-HB-C-A(1-772)
Plasmid#171085PurposeCo-expresses of WT-ELOA containing Elongin complex in bacteria. The resulting plasmid was used to generate a single expression construct encoding all 3Elongin subunits, with a 6-His tag on ELOBDepositorUseTagsHisExpressionBacterialMutationDeleted N-term 26 amino acids for expression purp…PromoterT5 promoterAvailable sinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1AUC-DelStem-CD20-Puro
Plasmid#209758PurposeLentiviral transfer plasmid to express the 5'-UTR and CDS of the human CD20 gene, MS4A1; variant 1 mRNA isoform with mutations to disrupt the uORFs and the stem-loop within the 5'-UTR.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralTagsExpressionMutationMutations to disrupt the uORFs and the stem-loop …PromoterAvailable sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only