We narrowed to 3,135 results for: actin
-
Plasmid#220245PurposeExpresses an EZH2 mutant for knockout/rescue experiments in mammalian cells.DepositorInsertEZH2 mt 2 (EZH2 Human)
UseLentiviralTagsFlagExpressionMammalianMutationF32A, R34A, D36A, K39A, PRKKKR494-499NAAIRSPromoterEF-1αAvailable sinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
Cntn1-Fc-His
Plasmid#72065PurposeExpresses the extracellular region of the Contactin 1 protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertCntn1 (Cntn1 Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMRX-IP-muGFP-hATG2A ΔWIR
Plasmid#215507PurposeExpresses GFP tagged human ATG2A with the mutation in WIPI interacting region.DepositorInsertAutophagy related 2A (ATG2A Human)
UseRetroviralTagsmuGFPExpressionMammalianMutationP656R (natural variant with no functional relevan…PromoterAvailable sinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
p(HA)HIF1alpha(401delta603)R27G
Plasmid#52215Purposemammalian expression of HA tagged HIF1alpha with a deletion of the N-terminal activation domain and R27G mutationDepositorInsertHIF1alpha (401delta603) R27G (HIF1A Human)
UseTagsHAExpressionMammalianMutationaa 401-603 deleted, removes the oxygen-dependent …PromoterCMVAvailable sinceApril 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
Cntn2-Fc-His
Plasmid#72066PurposeExpresses the extracellular region of the Contactin 2 protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertCntn2 (Cntn2 Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
Cntn2-AP-His
Plasmid#71940PurposeExpresses the extracellular region of the Contactin 2 protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertCntn2 (Cntn2 Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCS2-CIB1-mCherry-Rab8A
Plasmid#194333PurposeFor use in light-induced Rab8a protein inactivation through the interaction with CRY2DepositorUseTagsmcherryExpressionMammalianMutationPromoterCMV IE94Available sinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
Cntn5.1-AP-His
Plasmid#71943PurposeExpresses the extracellular region of the Contactin 5, isoform 1 protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertCntn5.1 (Cntn5 Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
Cntn5.1-Fc-His
Plasmid#72069PurposeExpresses the extracellular region of the Contactin 5, isoform 1 protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertCntn5.1 (Cntn5 Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMRX-IP-muGFP-hATG2A mLIR
Plasmid#215506PurposeExpresses GFP tagged human ATG2A with the mutation in LC3 interacting region.DepositorInsertAutophagy related 2A (ATG2A Human)
UseRetroviralTagsmuGFPExpressionMammalianMutationP656R (natural variant with no functional relevan…PromoterAvailable sinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
Coexpressed Free deadFPPS-NES
Plasmid#182492PurposeYeast integrative plasmid for expressing ERG20 (GAL10 promoter) and fusion protein deadFPPS-AcNES1 (GAL7 promoter). deadFPPS is ERG20(K197G-K254A), an inactive mutant of ERG20.DepositorInsertsFPPS
deadFPPS-NES
UseSynthetic Biology; Metabolic engineeringTagsExpressionYeastMutationPromoterGAL10 and GAL7Available sinceNov. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable sinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMVtight-HNF1A-FLAG-Hygro
Plasmid#183232PurposeLentiviral vector; Tet-on advanced system driving the expression of tagged HNF1ADepositorInsertHNF1 homeobox A (HNF1A Human)
UseLentiviralTagsAviTag and FLAG tagExpressionMutationPromotertight TREAvailable sinceNov. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-HNF1B-WT-Flag-UTR
Plasmid#183239PurposeExpression of FLAG tagged HNF1BDepositorInsertHNF1 homeobox B (HNF1B Human)
UseTagsFLAG tagExpressionMammalianMutationPromoterCMVAvailable sinceOct. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-MPP8-10xHis
Plasmid#194178PurposeExpresses MPP8-10xHis taggedDepositorInsertMPHOSPH8 (MPHOSPH8 Human)
UseTags10xHisExpressionMammalianMutationPromoterCMVAvailable sinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCS2-CIB1-mCherry-Rab11
Plasmid#140573PurposeFor use in light-induced protein inactivation through the interaction with CRY2DepositorUseTagsmCherryExpressionMammalianMutationPromoterCMV IE94Available sinceOct. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
tetO-HEY2
Plasmid#170691Purposedoxycycline-inducible overexpression of HEY2DepositorInsertHEY2 – hes related family bHLH transcription factor with YRPW motif 2 (HEY2 Human)
UseLentiviral; Doxycycline inducibleTagsExpressionMammalianMutationPromoterTRE promoter, Tet-ONAvailable sinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCW57-mCherry-2A-BRD4 Iso AdelCTD
Plasmid#137722PurposeDoxycycline Inducible Expression of mCherry-2A-FLAG-BRD4 long isoform missing its C-terminal, P-TEFb interacting domain (CTD)DepositorInsertBRD4 long isoform without its C-terminal, P-TEFb interacting domain (BRD4 Human)
UseLentiviralTagsFLAGExpressionMammalianMutationTruncated at amino acid 1328PromoterTight TRE promoterAvailable sinceJan. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
p(HA)HIF1alpha(401delta603) (L795V, C800S, L818S, L822V)
Plasmid#52216Purposemammalian expression of HA tagged HIF1alpha with a deletion of the N-terminal activation domain and LCLL mutationDepositorInsertHIF1alpha (401delta603) LCLL (HIF1A Human)
UseTagsHAExpressionMammalianMutationaa 401-603 deleted, removes the oxygen-dependent …PromoterCMVAvailable sinceApril 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCS2-CIB1-mCerulean-Rab11
Plasmid#140574PurposeFor use in light-induced protein inactivation through the interaction with CRY2DepositorUseTagsmCeruleanExpressionMammalianMutationPromoterCMV IE94Available sinceOct. 5, 2020AvailabilityAcademic Institutions and Nonprofits only