We narrowed to 8,402 results for: 221
-
Plasmid#221702PurposeLentiviral expression of human RNF8 (R42A) in mammalian cellsDepositorAvailable SinceAug. 19, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pHAGE-RNF8-C403S
Plasmid#221703PurposeLentiviral expression of human RNF8 (C403S) in mammalian cellsDepositorAvailable SinceAug. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-RNF8-S157A
Plasmid#221704PurposeLentiviral expression of human RNF8 (S157A) in mammalian cellsDepositorAvailable SinceAug. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV4-HA-MAD2
Plasmid#221696PurposeMammalian expression of HA-tagged human MAD2DepositorInsertMAD2
ExpressionMammalianAvailable SinceAug. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-FLAG-MAD2-RQ
Plasmid#221691PurposeMammalian expression of FLAG-tagged human MAD2 (R133E/Q134A)DepositorInsertMAD2
ExpressionMammalianMutationR133E, Q134AAvailable SinceAug. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Myc-BirA*-RNF8-C403S
Plasmid#221685PurposeMammalian expression of Myc-tagged BirA*-RNF8 (C403S) fusion protein for BioIDDepositorAvailable SinceAug. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Myc-BirA*-RNF8-R42A
Plasmid#221684PurposeMammalian expression of Myc-tagged BirA*-RNF8 (R42A) fusion protein for BioIDDepositorAvailable SinceAug. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4.1-Myc-RNF8-4A
Plasmid#221682PurposeMammalian expression of Myc-tagged human RNF8 (R477A/E478A/R479A/K480A)DepositorAvailable SinceAug. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4.1-Myc-RNF8-3A
Plasmid#221681PurposeMammalian expression of Myc-tagged human RNF8 (R477A/E478A/R479A)DepositorAvailable SinceAug. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4.1-Myc-RNF8-T198A
Plasmid#221680PurposeMammalian expression of Myc-tagged human RNF8 (T198A)DepositorAvailable SinceAug. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4.1-Myc-RNF8-S157A
Plasmid#221679PurposeMammalian expression of Myc-tagged human RNF8 (S157A)DepositorAvailable SinceAug. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4.1-Myc-RNF8-C403S
Plasmid#221678PurposeMammalian expression of Myc-tagged human RNF8 (C403S)DepositorAvailable SinceAug. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4.1-Myc-RNF8-R42A
Plasmid#221677PurposeMammalian expression of Myc-tagged human RNF8 (R42A)DepositorAvailable SinceAug. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBB328
Plasmid#221533PurposePlasmid for the introduction of Mariner transposon that inserts deoxyviolacein cassette behind indigenous promoters in target bacterial strain. Plasmid has tetracycline marker for selection.DepositorInsertsvioABCE
Mariner transposase and transposon backbone from pBB298 (originally from pEB001)
Tetracycline antibiotic cassette from pRK415
ExpressionBacterialPromoterNone, contains RBS siteAvailable SinceAug. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-GFAPp-PiGM-Iq(mCherry)
Plasmid#221609PurposeA recombinant AAV2 plasmid encoding the PiGM-Iq system with CRY2PHR, CIBN and mCherry as expression marker. GFAP promoter for astrocyte-selective expression.DepositorInsertPiGM-Iq (D387A, mCherry)
UseAAVMutationRGS2 1-53 truncation, CRYPHR D387APromoterGFAP promoterAvailable SinceAug. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-ZipT-2A-IvfChr (citrine, KV2.1)
Plasmid#221619PurposeA recombinant AAV2 plasmid encoding the ZipACR I151T mutant with soma targeting with KV2.1 motif and membrane expression enhanced vfChrimson-Citrine with soma targeting KV2.1 motif.DepositorInsertZipACR (I151V)KV2.1-2A-IvfChr-citrine-Kv2.1
UseAAVMutationZipACR (I151T) with soma targeting, vfChrimson w…PromoterHuman SynapsinAvailable SinceAug. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-GFAPp-PiGM-Iq(eGFP)
Plasmid#221606PurposeA recombinant AAV2 plasmid encoding the PiGM-Iq system with CRY2PHR, CIBN and EGFP as expression marker. GFAP promoter for astrocyte-selective expression.DepositorInsertPiGM-Iq (eGFP)
UseAAVMutationRGS2 1-53 truncationPromoterGFAP promoterAvailable SinceAug. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MCHpr-DREADD (Gq)-mCherry
Plasmid#221036PurposeExpresses Gq coupled DREADD hM3D under the rat pro-melanin-concentrating hormone promoterDepositorInsertDREADD Gq-mCherry
UseAAV; Rat targetingExpressionMammalianPromoterRat MCHAvailable SinceAug. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-ZipT-2A-IvfChr (mCherry, KV2.1)
Plasmid#221621PurposeA recombinant AAV2 plasmid encoding the ZipACR I151T mutant with soma targeting with KV2.1 motif and membrane expression enhanced vfChrimson-mCHerry with soma targeting KV2.1 motif.DepositorInsertZipACR (I151V)KV2.1-2A-IvfChr-mCherry-Kv2.1
UseAAVMutationZipACR (I151T) with soma targeting, vfChrimson w…PromoterHuman SynapsinAvailable SinceAug. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-IvfChr-citrine-KV2.1
Plasmid#221615PurposeA recombinant AAV2 plasmid encoding vfChrimson-citrine with trafficking enhancement and soma targeting with KV2.1 motif.DepositorInsertvfChrimson-citrine with membrane trafficking enhancement and soma targeting
UseAAVMutationvfChrimson-citrine with membrane trafficking enha…PromoterHuman SynapsinAvailable SinceAug. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-IvfChr-citrine
Plasmid#221614PurposeA recombinant AAV2 plasmid encoding vfChrimson-citrine with trafficking enhancement.DepositorInsertvfChrimson-citrine with membrane trafficking enhancement
UseAAVMutationvfChrimson with membrane trafficking enhancementPromoterHuman SynapsinAvailable SinceAug. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-ZipT-mScarlet-KV2.1
Plasmid#221617PurposeA recombinant AAV2 plasmid encoding the ZipACR I151V mutant and soma targeting with KV2.1 motif.DepositorInsertZipACR (I151T)-mScarlet with soma targeting
UseAAVMutationZipACR (I151T) with soma targetingPromoterHuman SynapsinAvailable SinceAug. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-ZipV-mScarlet-KV2.1
Plasmid#221616PurposeA recombinant AAV2 plasmid encoding the ZipACR I151T mutant and soma targeting with KV2.1 motif.DepositorInsertZipACR (I151V)-mScarlet with soma targeting
UseAAVMutationZipACR (I151V) with soma targetingPromoterHuman SynapsinAvailable SinceAug. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-ZipV-2A-IvfChr (citrine, KV2.1)
Plasmid#221618PurposeA recombinant AAV2 plasmid encoding the ZipACR I151V mutant with soma targeting with KV2.1 motif and membrane expression enhanced vfChrimson-Citrine with soma targeting KV2.1 motif.DepositorInsertZipACR (I151V)KV2.1-2A-IvfChr-citrine-Kv2.1
UseAAVMutationZipACR (I151V) with soma targeting, vfChrimson w…PromoterHuman SynapsinAvailable SinceAug. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEM-601[insert(+1) TA-rich]
Plasmid#221196Purpose601 nucleosome positioning sequence with an additional base pair inserted 22 nt from the dyad on the TA-rich side of the 601DepositorInsert601[insert(+1)TA-rich]
UseUnspecifiedMutation601 has an additional mutation added 22 bp from d…Available SinceAug. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDEST17-ScChd1[R126A/R130A]
Plasmid#221197PurposeScChd1-aa118-1274 chromatin remodeler with R126A and R130A mutationsDepositorInsertScChd1 (aa118-1274)
Tags6xHis-tag (Precission protease cleavable)ExpressionBacterialMutationR126A, R130APromoterT7Available SinceAug. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDEST17-ScChd1[Y137A]
Plasmid#221198PurposeScChd1-aa118-1274 chromatin remodeler with Y137A mutationDepositorInsertScChd1 (aa118-1274)
Tags6xHis-tag (Precission protease cleavable)ExpressionBacterialMutationY137APromoterT7Available SinceAug. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDEST17-ScChd1[∆ChEx]
Plasmid#221199PurposeScChd1-aa142-1274 chromatin remodeler with ChEx domain deletedDepositorInsertScChd1 (aa142-1274)
Tags6xHis-tag (Precission protease cleavable)ExpressionBacterialMutationdeleted amino acids 1-117 and 1275-1468Available SinceAug. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-PiGM-Iq(D387A eGFP)
Plasmid#221603PurposeA recombinant AAV2 plasmid encoding the light insensitive PiGM-Iq system with CRY2PHR(D387A), CIBN and EGFP as expression marker. hSynapsin promoter for panneuronal expression.DepositorInsertPiGM-Iq (D387A, eGFP)
UseAAVMutationRGS2 1-53 truncation, CRYPHR D387APromoterHuman SynapsinAvailable SinceAug. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
Vector 1174K
Plasmid#221017PurposeFluorescent based sex separator in Anopheles species mosquitoes (SEPARATOR)DepositorInsertEngineered dobulesex splicing module (Anopheles gambiae)
UseSynthetic BiologyExpressionInsectAvailable SinceAug. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOTvGPI(EP)-blast-mNG
Plasmid#221051PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInsertmNeonGreen
UseUnspecifiedPromoterread throughAvailable SinceAug. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOTvGPI(VSG)-blast-mNG
Plasmid#221050PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInsertmNeonGreen
UseUnspecifiedPromoterread throughAvailable SinceAug. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-TASL
Plasmid#221265PurposeExpression of TASL in mammalian cells by retroviral transductionDepositorAvailable SinceAug. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-empty-GFP
Plasmid#221843Purposeempty vector to clone custom sgRNA into BsaI sites to express sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertEGFP
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterCAGCAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-non-targeting-control -GFP
Plasmid#221844PurposeTol2 transposon expresses control non-targeting sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
non-targeting control sgRNA- GCACTGCTACGATCTACACC
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterGACG and U6.3 chickAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-DNM1L -GFP
Plasmid#221845PurposeTol2 transposon expressing sgRNA targeting chick DNM1L from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
DNM1L sgRNA-gTGTTTTCCGACCATCCTCTG
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterCAGC and U6.3 chickAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-MFN1-GFP
Plasmid#221846PurposeTol2 transposon expressing sgRNA targeting chick MFN1 from chick U6.3 promoter expresses GFP reporter from GAGC promoteDepositorInsertsEGFP
MFN1 sgRNA-GAGAAGAAGAGCGTCAAGGT
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterCAGC and U6.3 chickAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pENTR-ABCC1_K684I_STOP
Plasmid#221430PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorAvailable SinceJuly 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Myc-BirA*-RNF8
Plasmid#221683PurposeMammalian expression of Myc-tagged BirA*-RNF8 fusion protein for BioIDDepositorInsertRNF8 (RNF8 Human)
ExpressionMammalianAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-FLAG-MAD2
Plasmid#221690PurposeMammalian expression of FLAG-tagged human MAD2DepositorInsertMAD2
ExpressionMammalianAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-FLAG-p31(comet)
Plasmid#221692PurposeMammalian expression of FLAG-tagged human p31(comet)DepositorInsertMAD2BP1
ExpressionMammalianAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-FLAG-p31(comet)-QF
Plasmid#221693PurposeMammalian expression of FLAG-tagged human p31(comet) (Q83A/F191A)DepositorInsertMAD2BP1
ExpressionMammalianMutationQ83A, F191AAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-FLAG-CDC20
Plasmid#221694PurposeMammalian expression of FLAG-tagged human CDC20DepositorInsertCDC20 (CDC20 Human)
ExpressionMammalianAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-FLAG-RNF8
Plasmid#221695PurposeMammalian expression of FLAG-tagged human RNF8DepositorInsertRNF8 (RNF8 Human)
ExpressionMammalianAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FKBP-TASL(pLxIS-PLPLR)
Plasmid#221264PurposeExpression of TASL pLxIS-STING PLPLR in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
p-Tet-O-EYA2-Puro
Plasmid#221669PurposeExpresses EYA2 in mammalian cellsDepositorInsertEYA2 (EYA2 Human)
UseLentiviralAvailable SinceJuly 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
PD2529 human alpha5 ecto
Plasmid#221394PurposeMammalian expression of human integrin alpha5 ectodomainDepositorInsertintegrin alpha5 ectodomain (ITGA5 Human)
TagsCD33 secretion peptide (MPLLLLLPLLWAGALA) and HR…ExpressionMammalianMutationcodon optimized for human mature residues _5 F1 t…Available SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
p-Tet-O-Foxp1A-Puro
Plasmid#221665PurposeExpresses Foxp1A in mammalian cellsDepositorInsertFoxp1A (Foxp1 Mouse)
UseLentiviralAvailable SinceJuly 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-eGFP_myr
Plasmid#221412PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInserteGFP_myr
ExpressionMammalianAvailable SinceJuly 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-eGFP
Plasmid#221413PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInserteGFP
ExpressionMammalianAvailable SinceJuly 18, 2024AvailabilityAcademic Institutions and Nonprofits only