We narrowed to 8,952 results for: aav
-
Plasmid#59332PurposeExpresses splitTVA-P2A-EGFPDepositorInsertsplitTVA950-P2A-EGFP
UseAAV and Cre/LoxTagsGFPExpressionMammalianPromoterCAGAvailable sinceSept. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-Chronos-GFP
Plasmid#99232PurposeAAV-mediated expression of Chronos-GFP under the CAG promoter. Using bGHpA signal.DepositorInsertChronos-GFP
UseAAVTagsGFPExpressionMammalianPromoterCAGAvailable sinceDec. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
p-AAV-sh[SNCA]
Plasmid#75437Purposeknockdown alpha-synuclein in rat neuronsDepositorAvailable sinceAug. 9, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-BD-hSynTet-TRE-DIO-mNeonGreen-E2
Plasmid#242784PurposeBidirectional AAV transfer plasmid expressing hSyn-tTA and TRE-FLEX-mNeonGreen-E2 in the other direction.DepositorInsertsmNeonGreen
tTA-Advanced
UseAAVTagsE2PromoterTRE and hSynAvailable sinceSept. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-BD-hSynTet-TRE-DIO-mNeonGreen-HA
Plasmid#242786PurposeBidirectional AAV transfer plasmid expressing hSyn-tTA and TRE-FLEX-mNeonGreen-HA in the other direction.DepositorInsertsmNeonGreen
tTA-Advanced
UseAAVTagsHAPromoterTRE and hSynAvailable sinceSept. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-BD-hSynTet-TRE-DIO-mNeonGreen-S1
Plasmid#242793PurposeBidirectional AAV transfer plasmid expressing hSyn-tTA and TRE-FLEX-mNeonGreen-S1 in the other direction.DepositorInsertsmNeonGreen
tTA-Advanced
UseAAVTagsS1PromoterTRE and hSynAvailable sinceSept. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-BD-hSynTet-TRE-DIO-mNeonGreen-T7
Plasmid#242796PurposeBidirectional AAV transfer plasmid expressing hSyn-tTA and TRE-FLEX-mNeonGreen-T7 in the other direction.DepositorInsertsmNeonGreen
tTA-Advanced
UseAAVTagsT7PromoterTRE and hSynAvailable sinceSept. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb HMEJ donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97308PurposeHMEJ donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb HMEJ donor
UseAAV and Mouse TargetingExpressionMammalianPromoterU6, EF1aAvailable sinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV2-DEST(r)
Plasmid#190238PurposeGateway destination vector, empty AAV vector backboneDepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable sinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-GCaMP6f-P2A-PAmCherry
Plasmid#133412PurposeFluorescent reporter for calcium imaging and photoactivation.DepositorInsertGCaMP6f-P2A-PAmCherry
UseAAVExpressionMammalianPromoterCAGAvailable sinceDec. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-hCA4-miR122
Plasmid#244908PurposeAAV transgene plasmid encoding human CA4 with miR-122 target siteDepositorInserthuman CA-IV
UseAAVAvailable sinceNov. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV2ss-U6-sgHTT1-7sk-sgCas9
Plasmid#190900PurposeAAV-KamiCas9 vector expressing sgGFP and human HTT sgRNAsDepositorAvailable sinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorPublicationInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available sinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-dSaCas9-NLS-3xHA-3xSunTag_bGHpA
Plasmid#177345PurposeAAV expression of a catalytically inactive SaCas9 (dSaCas9) fused with three copies of SunTag sequence from Synapsin promoterDepositorInsertdead hSaCas9
UseAAV and CRISPRTags3x GCN4 peptide, 3xHA, and NLSExpressionMammalianMutationD10A, N580APromoterSynapsinAvailable sinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-E22-ChR2GFP2x
Plasmid#153436PurposeAAV vector to drive the expression of dChr2-GFP-P2A-GFP in PV cortical interneuronsunder the control of the E22 regulatory elementDepositorInsertChr2-GFP-P2A-GFP
UseAAVAvailable sinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-seTurboID
Plasmid#237886PurposeAAV vector for Cre-dependent expression of seTurboIDDepositorInsertseTurboID
UseAAV and Cre/LoxTagsFLAG tagExpressionMammalianPromoterCAGAvailable sinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-tdKatushka2-WPRE
Plasmid#193344PurposeAAV-mediated expression of tdKatushka2 under the TRE promoter in mammalian cellsDepositorInserttdKatushka2
UseAAVExpressionMammalianPromoterTREAvailable sinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.FLEX.SYFP2-POST-T2A-dTomato.FLEX.WPRE.SV40
Plasmid#105983PurposeThis AAV plasmid in the presence of Cre recombinase expresses an extracellular SYFP2 fused to the neuroligin-1 cytoplasmic domain for targeting to the synapse with a cell fill dTomato.DepositorInsertFLEX-SYFP2-POST-T2A-dTomato.FLEX
UseAAV and Cre/LoxTagsSYFP2-POST, T2A-dTomato, and mycExpressionMammalianPromoterhuman Synapsin 1Available sinceOct. 9, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
AAV-Gfa104-jGCaMP8m
Plasmid#254432PurposeFor production of AAV containing jGCaMP8mDepositorInsertmedium fast calcium green fluorescent indicator
UseAAVPromoterGfa104Available sinceMay 18, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-OTp-GCaMP6s
Plasmid#192945PurposeTo drive GCaMP6s under the control of mouse oxytocin promoterDepositorInsertGCaMP6s
UseAAVAvailable sinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only