We narrowed to 170,876 results for: addgene
-
Plasmid#207105PurposepX330 based plasmid for expression of Cas9 and the CGCTATCAAGATTTATACCT sgRNA to target the SHLD3 locus..DepositorInsertCGCTATCAAGATTTATACCT
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATG13 sgRNA
Plasmid#207558PurposepX330 expressing Cas9 and a sgRNA targeting the ATG13 locusDepositorInsertggaaactgatctcaattccc
ExpressionMammalianPromoterCMV and U6Available SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV/CMV-SCLM
Plasmid#216758PurposeAAV2 transfer vector with the CMV promoter for ubiquitous expression of SuperClomeleonDepositorInsertSuperClomeleon followed by WPRE and human growth hormone polyA terminator
UseAAVExpressionMammalianMutationS30R and 11 AA deletion in the Cerulean CFP moiet…PromoterCMV (cytomegalovirus)Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD2 N-terminal sgRNA
Plasmid#207098PurposepX330 based plasmid for expression of Cas9 and the TTTTTATCAGAAATCATGAG sgRNA to target the SHLD2 locus.DepositorInsertTTTTTATCAGAAATCATGAG
ExpressionMammalianPromoterCMV and U6Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
HaloTag KO sgRNA
Plasmid#207102PurposepX330 based plasmid for expression of Cas9 and the GTCGATGTTGGTCCGCGCGA sgRNA to target the HaloTag coding sequence.DepositorInsertGTCGATGTTGGTCCGCGCGA
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDC1 N-terminal sgRNA
Plasmid#207090PurposepX330 based plasmid for expression of Cas9 and the GTATCCTTCCCAGATCATGG sgRNA to target the MDC1 locus.DepositorInsertGTATCCTTCCCAGATCATGG
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #2
Plasmid#207106PurposepX330 based plasmid for expression of Cas9 and the CTGAAGGAACAGACTAATTC sgRNA to target the SHLD3 locus..DepositorInsertCTGAAGGAACAGACTAATTC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
53BP1 KO sgRNA
Plasmid#207104PurposepX330 based plasmid for expression of Cas9 and the AGATTCTCAGCCTGAAAGCC sgRNA to target the 53BP1 coding sequence.DepositorInsertAGATTCTCAGCCTGAAAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLIK NPIPB11-FLAG zeo
Plasmid#192331PurposeLentiviral expression vector for an inducible NPIPB11-FLAGDepositorAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEN_TT NPIPB11-FLAG
Plasmid#192308PurposeGateway entry vector for an inducible NPIPB11-FLAGDepositorAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEN_TT 3xFLAG-NUP37
Plasmid#192299PurposeGateway entry vector for an inducible 3xFLAG-NUP37DepositorAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEN_TT 3xFLAG-PFN2_variant2
Plasmid#192300PurposeGateway entry vector for an inducible 3xFLAG-PFN2_variant2DepositorAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-AsCpf1-2A-GFP-U6-tdTomato-sgRNA
Plasmid#194724Purposebased on (CAGGS-AsCpf1-2A-GFP-U6-sgRNA-cloning vector, Addgene 159281), with guide RNA that target tdTomatoDepositorInsertAsCpf1
UseCRISPRExpressionMammalianAvailable SinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
Venus-Bik-cb5-pEGFP-C1
Plasmid#177431PurposeTo express Venus fused to the N-terminus of the Bcl-2 family protein, Bik, with its membrane binding region (MBR) replaced with Cb5 targeting sequence. Swap made in original Addgene #166737.DepositorInsertBik, Bcl-2-interacting killer, or Apoptosis inducer NBK (BIK Human)
TagsVenusExpressionMammalianMutationBik MBR removed (after position 136) and replaced…PromoterCMVAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
Venus-Bik-AA-pEGFP-C1
Plasmid#177430PurposeTo express Venus fused to the N-terminus of the Bcl-2 family protein, Bik, with 2 sites of phosphorylation mutated to alanine. T33A and S35A mutations made to Addgene #166737.DepositorInsertBik, Bcl-2-interacting killer, or Apoptosis inducer NBK (BIK Human)
TagsVenusExpressionMammalianMutationThreonine 33 and Serine 35 replaced with alaninePromoterCMVAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSCL.004
Plasmid#184969PurposeNegative control, empty integrating inducible casetteDepositorTypeEmpty backboneExpressionYeastAvailable SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
NODAL-T7TS-C312S
Plasmid#115263PurposeFor in vitro transcription of human NODAL open reading frame (with a mutated Cysteine residue) RNADepositorAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
NODAL-T7TS-N72A-N199A
Plasmid#115264PurposeFor in vitro transcription of human NODAL open reading frame (with two mutated N-glycosylation sites) RNADepositorAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET15b/GVcl 1-1066 /*TBM
Plasmid#162781Purposeamplification of Gallus gallus Vcl mutated in Tankyrase Binding Domain IIDepositorArticleAvailable SinceMay 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Nod-BFP2-TSERex
Plasmid#124785PurposeExpresses the proton pump rhodopsin in mammalian cells under CAG promoterDepositorInsertNod-BFP2
ExpressionMammalianPromoterCAGAvailable SinceMay 9, 2019AvailabilityAcademic Institutions and Nonprofits only