We narrowed to 14,273 results for: cas9
-
Plasmid#169630PurposepX330 derived vector for PCAG driven expression of SpCas9 and PU6 driven expression of guide RNA OGTS40 (5' GGGGCCACTAGGGACAGGAT 3') targeting position 55115755 of chromosome 19.DepositorInsertU6-driven gRNA expression and PCAG-driven SpCas9 expression
ExpressionMammalianPromoterU6 / PCAGAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVH333-1-Tier1-PhCMV-dCas9-3xNLS-VP64
Plasmid#169597PurposeTier-1 vector encoding PhCMV-driven dCas9-3xNLS-VP64 expression (PhCMV-dCas9-3xNLS-VP64-pA).DepositorInsertdead S.pyogenes Cas9 - VP64 fusion
ExpressionMammalianPromoterPhCMVAvailable SinceJuly 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGG438
Plasmid#165486PurposeVector for expression of the SpCas9 VRKG variant in human cells: CMV-T7-humanVRKG(SpCas9, D1135V/S1136R/D1332K/R1333G)-1xNLS(SV40)-3xFLAGDepositorInsertMammalian codon-optimized Streptococcus pyogenes Cas9 VRKG(D1135V/S1136R/D1332K/R1333G)-1xNLS(SV40)-3xFlag
UseCRISPRTags3x FLAG and SV40 NLSExpressionMammalianMutationD1135V, S1136R, D1332K, and R1333G mutations in S…PromoterCMV and T7Available SinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
CAPTURE1-1_pLVX-EF1a-BirA-P2A-FB-dCas9-IRES-zsGreen1
Plasmid#138417PurposeCAPTURE1.1 vector containing BirA-V5-His, P2A, FB-dCas9, IRES and zsGreen1DepositorInsertsBirA
dCas9
UseLentiviralTagsFLAG, Avi-tag and V5, HisPromoterEF1aAvailable SinceJuly 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSA097 HNRNPK_IVS3-Cas9-BFP
Plasmid#249147PurposeOverexpression of SpCas9-BFP with HNRNPK IVS3 intron in 5' UTR and blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertHNRNPK_IVS3-Cas9-TagBFP (HNRNPK Human, S. pyogenes Cas9, synthetic)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHNRNPK IVS3 intronPromoterEF1aAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pHR-UCOE-SFFV-dCas9-KRAB(Kox1)-MeCP2-P2A-EGFP
Plasmid#188902PurposedCas9 with a C-term NLS-KRAB(Kox1)-MeCP2 fusion (no linker), and GFP linked by a P2A site from a SFFV promoter with an upstream ubiquitous chromatin opening elementDepositorInsertdCas9-KRAB(Kox1)-MeCP2
UseLentiviralTagsNLS-KRAB(Kox1)-MeCP2 fusion (no linker) and P2A-G…PromoterSFFVAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE2-P2A-PuroR
Plasmid#196962PurposeExpresses PE2 with puromycin resistanceDepositorInsertPE2-P2A-Puro
ExpressionMammalianPromoterCMVAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABEmax-SpG
Plasmid#195278PurposeAllows for in vitro transcription of original pCMV-T7-ABEmax(7.10)-SpG-P2A-EGFP (RTW4562) without EGFPDepositorInserthuman codon optimized ABEmax(7.10) SpCas9 variant named SpG without EGFP
ExpressionMammalianPromoterCMVAvailable SinceJune 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJCKan
Plasmid#185862PurposeThe CRISPR/Cas9-and-gRNA-expressing plasmid with a G418-resistent selectable markerDepositorInsertPTDH3-Cas9(N); PSNR52-srRNA-TSUP4; KanMX4
ExpressionYeastMutationNoneAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUC19-G9QLF2
Plasmid#103111PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertG9QLF2(Cas9 coding gene from Bacillus smithii 7_3_47FAA)
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-J9E534
Plasmid#103078PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertJ9E534(Cas9 coding gene from Alicyclobacillus hesperidum URH17-3-68)
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-B1UZL4
Plasmid#103085PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertB1UZL4(Cas9 coding gene from Clostridium perfringens D str. JGS1721)
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSLPB2B-FKBP12_F36V-SpdCas9-KRAB-tagBFP-PGK-Blasticidin
Plasmid#187953PurposeFKBP12 (F36V mutant) degron-tagged dCas9-KRAB domain fused to tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertFKBP12_F36V-SpdCas9-KRAB-tagBFP
UseCRISPR and Synthetic BiologyTagsGGSExpressionMammalianAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SMVP-Cas9N-U6-gRNA P2
Plasmid#80944PurposeExpresses Cas9N in mammalian cells; expresses gRNA P2 for Pd-l1 bindingDepositorInsertCas9N
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable SinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPB-TREG3G-PE2-rtTA3G-P2A-eGFP
Plasmid#196971PurposePiggybac vector with doxycyclin-inducible prime editor for mammalian cellsDepositorInsertsCas9-RT
rtTA3G-P2A-eGFP
ExpressionMammalianPromoterPGK and TREG3GAvailable SinceAug. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
MultiMate-HITI-2c ACTB
Plasmid#206267PurposeAll in one recombinant baculovirus production vector. Encodes Cas9, sgRNA and donor for homology independent targeted integration in the ACTB locus.DepositorInsertSpCas9 (S. Pyogenes), hACTB HITI-2c donor, mCherry, Puro-R, hU6 hACTB sgRNA, AcrIIA4, eGFP
UseCRISPR; Recombinant baculovirus productionExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJCble
Plasmid#185861PurposeThe CRISPR/Cas9-and-gRNA-expressing plasmid with a phleomycin-resistent selectable markerDepositorInsertPTDH3-Cas9(N); PSNR52-srRNA-TSUP4; ble
ExpressionYeastMutationNoneAvailable SinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
Bassik lab Mouse CRISPR-Cas9 Deletion Library - Apoptosis and cancer
Pooled Library#1000000121PurposeCRISPR gRNA mouse knockout pooled library - Apoptosis and cancerDepositorAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
Bassik lab Mouse CRISPR-Cas9 Deletion Library - Gene Expression
Pooled Library#1000000123PurposeCRISPR gRNA mouse knockout pooled library - Gene expressionDepositorAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSLQ2815 pPB: CAG-Puro-WPRE PGK-KRAB-tagBFP-SpdCas9
Plasmid#84245PurposeExpresses direct fusion KRAB-Sp dCas9DepositorInsertsKRAB-tagBFP-Sp dCas9
Puro
UseCRISPR and Synthetic Biology; PiggybacTags2xNLS (SV40), HA tag, KRAB, and tagBFPExpressionMammalianPromoterCAG and PGKAvailable SinceNov. 9, 2016AvailabilityAcademic Institutions and Nonprofits only