We narrowed to 45,585 results for: CAT

#75184

Mammalian expression of ATP2A2

Jonathan Lytton, Gary Shull

Gunteski-Hamblin et al J Biol Chem. 1988 Oct 15;263(29):15032-4

June 8, 2016

Academic Institutions and Nonprofits only

#125684

expresses human ADSL protein with a C-terminal 2XStrep affinity tag

Stephen Benkovic

Liu et al J Proteome Res. 2019 May 3;18(5):2078-20

May 31, 2019

Academic Institutions and Nonprofits only

#107286

Plasmid can be used for Drosophila S2 driven secretion of extracellular part of human interferon-_ receptor 2.

Bohdan Schneider

Mikulecky et al Acta Crystallogr D Struct Biol. 2016 Sep

March 7, 2018

Academic Institutions and Nonprofits only

#239100

pUltra-EGFP bi-cistronic lentiviral vector expressing EGFP and truncated NRL.

David Cobrinik

Shayler et al eLife 13:RP101918

Sept. 17, 2025

Academic Institutions and Nonprofits only

#239096

Expresses truncated NRL, driven by EF1α promoter.

David Cobrinik

Shayler et al eLife 13:RP101918

Sept. 2, 2025

Academic Institutions and Nonprofits only

#226205

Electroporation knockout plasmid (pK18sB) to delete the CBBp, membrane-bound hydrogenase, soluble hydrogenase, and intervening sequences (∆CBBp ∆MBH ∆SH).

Christopher Johnson

Calvey et al Metab Eng. 2023 Jan;75:78-90. doi: 10.10

Nov. 18, 2024

Industry, Academic Institutions, and Nonprofits

#206068

expression of rabbit Cav2.2 calcium channel with a N-terminal GFP tag and a D122A mutation that disrupts the interaction with ?2?-1

Annette Dolphin

Page et al J Neurosci. 2004 Jun 9;24(23):5400-9. do

Oct. 12, 2023

Academic Institutions and Nonprofits only

#114130

Mammalian expression of the G2A mutant of the N-terminal 47 residues of mouse PKA Catalytic subunit α C-terminally tagged by monomeric paGFP.

Haining Zhong

Tillo et al Cell Rep. 2017 Apr 18;19(3):617-629. doi

Oct. 9, 2018

Academic Institutions and Nonprofits only

#91602

Express sgRNA targeting human DPP4

Lindy Barrett

Hazelbaker et al Stem Cell Reports. 2017 Oct 10;9(4):1315

Oct. 12, 2017

Industry, Academic Institutions, and Nonprofits

#91599

Express sgRNA targeting human DLGAP1

Lindy Barrett

Hazelbaker et al Stem Cell Reports. 2017 Oct 10;9(4):1315

Oct. 12, 2017

Academic Institutions and Nonprofits only

#87398

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1206a sequence CGAACATTTTTCCATGCGCT in yeast chromosome 12.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#62637

mammalian expression of human duplicated Alpha7-2 bp deletion (CHRFAM7A-∆2bp) with YFP fused into M3-M4 loop

Henry Lester

Wang et al J Biol Chem. 2014 Sep 19;289(38):26451-6

March 10, 2015

Academic Institutions and Nonprofits only

#119953

Expresses GPPS and LimS, for the production of GPP and (S)-limonene, in Escherichia coli.

Nigel Scrutton

Jervis et al ACS Synth Biol. 2018 Dec 18. doi: 10.102

March 12, 2019

Academic Institutions and Nonprofits only