We narrowed to 17,803 results for: ERG
-
Plasmid#1792DepositorInsertSIRT1 (SIRT1 Human)
UseTagsFlagExpressionMammalianMutationH363Y, deacetylase domain mutationPromoterAvailable sinceMay 3, 2006AvailabilityAcademic Institutions and Nonprofits only -
pJL046
Plasmid#198807PurposeIn vivo neuronal inhibition through histamine-gated chloride channel. Neurons expressing HisCl1 transgene are inhibited after addition of histamine.DepositorInsert15xUAS::HisCl1-SL2-GFP::let-858 3'UTR
UseTagsExpressionWormMutationPromoterAvailable sinceMay 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGGD_MiniTurboID-YFP
Plasmid#222434PurposeGolden Gate / Green Gate module for adding MiniTurboID and YFP as C-terminus of target protein.DepositorInsertMiniTurboID (BirA mutant)
UseGolden gate / green gate compatible cloning vectorTagsLinker and YFPExpressionMutationaa1-63 deleted; Q65P, I87V, R118S, E140K, Q141R, …PromoterAvailable sinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSL3718 (pQCascade_Pse)
Plasmid#200899PurposeExpresses human codon-optimized Pseudoalteromonas Cas7, Cas8, Cas6, and TniQ from a CMV promoter, in a polycistronic vector format separated by T2A sequences.DepositorInsertPseCas7, PseCas8, PseCas6, PseTniQ
UseTagsNLS (TniQ) and NLS, T2A (Cas7, Cas8, Cas6)ExpressionMammalianMutationPromoterAvailable sinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
R4pGWB601_UBQ10p-Turbo-NES-YFP
Plasmid#127366PurposeBinary vector for expressing cytosolic TurboID-YFP under the UBQ10 promoter in plantsDepositorInsertTurboID (BirA mutant)
UseTagsGS linker, NES, V5, and YFPExpressionPlantMutationQ65P, I87V, R118S, E140K, Q141R, S150G, L151P, V1…PromoterArabidopsis UBQ10 promoterAvailable sinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDF0114 pU6-Eco31i-Eco31i-DisCas7-11 mature DR guide scaffold with golden gate site
Plasmid#172508PurposeEncodes the mature DisCas7-11 DR along with a golden gate site for spacer cloningDepositorInsertpU6-Eco31i-Eco31i-DisCas7-11 mature DR guide scaffold with golden gate site
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBABE-puro TPR-Met
Plasmid#10902DepositorUseRetroviralTagsExpressionMammalianMutationConstitutively active form of the c-Met receptorPromoterAvailable sinceFeb. 13, 2006AvailabilityAcademic Institutions and Nonprofits only -
pSL1425 (pSPIN, pCDF backbone)
Plasmid#160735PurposeSingle-plasmid V. cholerae CAST system, encodes all proteins, crRNA, and donor DNA. Entry vector encodes non-targeting crRNA and has BsaI sites for spacer cloning. pCDF backbone.DepositorInsertVchCAST proteins, crRNA, and donor DNA
UseTagsExpressionBacterialMutationPromoterJ23119Available sinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
7TFP CDH1 reporter
Plasmid#91704Purposelentiviral luciferase reporter containing CDH1 promoterDepositorInsertCDH1 promoter (CDH1 Human)
UseLentiviral and LuciferaseTagsluciferaseExpressionMammalianMutationPromoterCDH1Available sinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pORTMAGE-3
Plasmid#72678PurposeExpresses Lambda Red recombinases and a dominant negative MutL allele all controlled by temperature sensitve cI857 repressor for high precision and efficiency MAGE experiments. Kan resistance marker.DepositorInsertmutL E32K
UseTagsnoneExpressionBacterialMutationE32K mutation conferring dominant mutator phenoty…PromoterAvailable sinceFeb. 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
FLAG-FOXO3a WT
Plasmid#8360DepositorInsertFOXO3a (FOXO3 Human)
UseTagsFlagExpressionMammalianMutationPromoterAvailable sinceMarch 14, 2006AvailabilityAcademic Institutions and Nonprofits only -
pGGB_YFP-MiniTurboID
Plasmid#222433PurposeGolden Gate / Green Gate module for adding YFP and MiniTurboID as N-terminus of target protein.DepositorInsertMiniTurboID (BirA mutant)
UseGolden gate / green gate compatible cloning vectorTagsLinker and YFPExpressionMutationaa1-63 deleted; Q65P, I87V, R118S, E140K, Q141R, …PromoterAvailable sinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
R4pGWB601_UBQ10p-Turbo-YFP-NLS
Plasmid#127368PurposeBinary vector for expressing nuclear TurboID-YFP under the UBQ10 promoter in plantsDepositorInsertTurboID (BirA mutant)
UseTagsGS linker, NLS, V5, and YFPExpressionPlantMutationQ65P, I87V, R118S, E140K, Q141R, S150G, L151P, V1…PromoterArabidopsis UBQ10 promoterAvailable sinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLV-neo-CD2-FAK
Plasmid#37013DepositorUseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceOct. 19, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro shRNA beta-catenin
Plasmid#18803Purpose3rd gen lentiviral vector for knocking down beta-catenin gene expressionDepositorInsertb-catenin shRNA (CTNNB1 Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterU6Available sinceJuly 22, 2008AvailabilityAcademic Institutions and Nonprofits only -
pBW2661_pCAG-PV1-iCre-N270-L1-ABI-NLS-BGHpA
Plasmid#108745PurposeExpresses N-terminus to aa270 of Cre recombinase fused to ABI CIDDepositorInsertCre recombinase fragment N-terminus to aa270
UseCre/Lox and Synthetic BiologyTagsABI,NLSExpressionMammalianMutationPromoterpCAGAvailable sinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBW2663_pCAG-PV1-PYL-L1-iCre-271C-NLS-BGHpA
Plasmid#108746PurposeExpresses aa271 to C-terminus of Cre recombinase fused to PYL CIDDepositorInsertCre recombinase fragment aa271 to C-terminus
UseCre/Lox and Synthetic BiologyTagsNLS and PYLExpressionMammalianMutationPromoterpCAGAvailable sinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pORTMAGE-4
Plasmid#72679PurposeExpresses Lambda Red recombinases and a dominant negative MutL allele all controlled by temperature sensitve cI857 repressor for high precision and efficiency MAGE experiments. Cam resistance marker.DepositorInsertmutL E32K
UseTagsnoneExpressionBacterialMutationE32K mutation conferring dominant mutator phenoty…PromoterAvailable sinceFeb. 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
R4pGWB601_UBQ10p-miniTurbo-YFP-NLS
Plasmid#127370PurposeBinary vector for expressing nuclear miniTurbo-YFP under the UBQ10 promoter in plantsDepositorInsertminiTurbo (BirA mutant)
UseTagsGS linker, NLS, V5, and YFPExpressionPlantMutationaa1-63 deleted; Q65P, I87V, R118S, E140K, Q141R, …PromoterArabidopsis UBQ10 promoterAvailable sinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSCIP-hCD69-TdTomato
Plasmid#154095PurposeSelf-Cutting and Integrating CRISPR backbone targeting human CD69 promoter with TdTomato reporter transgeneDepositorInserts[5HA]-P2A-tdTomato-[3HA]
hCD69 targeting sgRNA - AGCTCTTTGCATCCGGAGAG
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only