We narrowed to 4,502 results for: erf
-
Plasmid#154420PurposeGateway-compatible Entry vectorDepositorInsertORF6 (ORF6 SARS-CoV-2 isolate Wuhan-Hu-1)
UseGateway-compatible entry vector, with insert of o…MutationMany synonymous changes due to codon optimizationAvailable SinceJuly 7, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR223 SARS-CoV2 TEV-ORF7A
Plasmid#154421PurposeGateway-compatible Entry vectorDepositorInsertORF7A (ORF7a SARS-CoV-2 isolate Wuhan-Hu-1)
UseGateway-compatible entry vector, with insert of o…MutationMany synonymous changes due to codon optimizationAvailable SinceJuly 6, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR223 SARS-CoV2 TEV-ORF8
Plasmid#154423PurposeGateway-compatible Entry vectorDepositorInsertORF8 (ORF8 SARS-CoV-2 isolate Wuhan-Hu-1)
UseGateway-compatible entry vector, with insert of o…MutationMany synonymous changes due to codon optimizationAvailable SinceJuly 6, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR223 SARS-CoV2 TEV-NSP15
Plasmid#154413PurposeGateway-compatible Entry vectorDepositorInsertNSP15 (ORF1ab SARS-CoV-2 isolate Wuhan-Hu-1)
UseGateway-compatible entry vector, with insert of n…MutationMany synonymous changes due to codon optimizationAvailable SinceJuly 2, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR223 SARS-CoV2 TEV-NSP9
Plasmid#154408PurposeGateway-compatible Entry vectorDepositorInsertNSP9 (ORF1ab SARS-CoV-2 isolate Wuhan-Hu-1)
UseGateway-compatible entry vector, with insert of n…MutationMany synonymous changes due to codon optimizationAvailable SinceJuly 1, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
Pet22b-mCherry-TEAD4-IDR
Plasmid#166442PurposeBacterial expression of 6x His tagged mCherry-TEAD4 -IDR fusion proteinDepositorInsertmCherry, TEAD4-IDR (TEAD4 Human)
ExpressionBacterialAvailable SinceApril 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
p21-S208C/S242R/M694V-MEFV
Plasmid#134706PurposeLentiviral expression of human MEFV S208C/S242R/M694V after doxycycline administrationDepositorInsertMEFV (MEFV Human)
UseLentiviralTags3xFlagMutationp.S208C/S242R/M694VPromoterTRE2 (Dox-inducible)Available SinceDec. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
mEGFP-N1 YAPS127A- L318E
Plasmid#166465PurposeExpresses fusion of mEGFP and YAPS127A- L318EDepositorAvailable SinceApril 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2 kif26b sgRNA1
Plasmid#102857PurposeExpresses sgRNA targeting mouse Kif26bDepositorInsertMouse Kif26b (Kif26b Mouse)
UseLentiviralAvailable SinceApril 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2 kif26b sgRNA2
Plasmid#102858PurposeExpresses sgRNA targeting mouse Kif26bDepositorInsertMouse Kif26b (Kif26b Mouse)
UseLentiviralAvailable SinceDec. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR207 SARS-CoV-2 E 27nt-del_nostop
Plasmid#153955PurposeGateway-compatible Entry vector, with insert of E CDS bearing a 27nt deletion from SARS-CoV-2 genomic analysis in Davidson et al. 2020DepositorInsertE (E SARS-CoV-2 isolate Wuhan-Hu-1)
UseGateway-compatible entry vectorMutationMany synonymous changes due to codon optimizationAvailable SinceJune 23, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR223 SARS-CoV2 TEV-NSP8
Plasmid#154407PurposeGateway-compatible Entry vectorDepositorInsertNSP8 (ORF1ab SARS-CoV-2 isolate Wuhan-Hu-1)
UseGateway-compatible entry vector, with insert of n…MutationMany synonymous changes due to codon optimizationAvailable SinceJuly 1, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCDF-casBCDE(+6)
Plasmid#89728PurposeExpresses the Cascade subunits Cse2, Cas7, Cas5, Cas6e and pre-crRNA containing a longer version of the wt spacer (+6) extended by 6 nucleotides at the leader-distal end.DepositorInsertCRISPR array
ExpressionBacterialMutationDerivative CRISPR array containing a longer versi…Available SinceMay 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNK845
Plasmid#219746PurposeMoClo-compatible Level 0 promoterless vector encoding mutant of Neonothopanus nambi luciferase nnLuz_v4 codon-optimised for expression in Pichia pastoris, Homo sapiensDepositorInsertmutant of fungal luciferase
UseLuciferase and Synthetic BiologyMutationI3S, N4T, F11L, I63T, T99P, T192S, A199PAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
TFORF3064
Plasmid#144540PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSN-A112C-1A32
Plasmid#191241PurposeExpresses nuclease A-H124L from Staphylococcus aureus, with an A112C mutation, fused through a flexible linker to the transmembrane domain of poly-Leu-1A32 and a His-tag, for fluorescent studies.DepositorInsertnuc (nuclease A), HLA-A (HLAA) (predicted interfacial residues of the transmembrane domain in a poly-leu background)
Tagsnuclease A from S. aureus fused to the poly-Leu T…ExpressionBacterialMutationChanged Alanine 112 to Cysteine in SN, and predic…PromoterT7 promoterAvailable SinceFeb. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSN-A112C-1A31
Plasmid#191242PurposeExpresses nuclease A-H124L from Staphylococcus aureus, with an A112C mutation, fused through a flexible linker to the transmembrane domain of poly-Leu-1A31 and a His-tag, for fluorescent studies.DepositorInsertnuc (nuclease A), HLA-A (HLAA) (predicted interfacial residues of the transmembrane domain in a poly-leu background)
Tagsnuclease A from S. aureus fused to the poly-Leu T…ExpressionBacterialMutationChanged Alanine 112 to Cysteine in SN, and predic…PromoterT7 promoterAvailable SinceJan. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSN-A112C-CP8B1
Plasmid#191240PurposeExpresses nuclease A-H124L from Staphylococcus aureus, with an A112C mutation, fused through a flexible linker to the transmembrane domain of poly-Leu-CP8B1 and a His-tag, for fluorescent studies.DepositorInsertnuc (nuclease A), CYP8B1 (CYP12) (predicted interfacial residues of the transmembrane domain in a poly-leu background)
Tagsnuclease A from S. aureus fused to the poly-Leu T…ExpressionBacterialMutationChanged Alanine 112 to Cysteine in SN, and predic…PromoterT7 promoterAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
Pet22b-mEGFP-YAP-C-IDR
Plasmid#166441PurposeBacterial expression of 6x His tagged mEGFP-YAP1-C-IDR fusion proteinDepositorInsertmEGFP, YAP-C-IDR(266-504) (YAP1 Human)
ExpressionBacterialAvailable SinceApril 7, 2021AvailabilityAcademic Institutions and Nonprofits only