We narrowed to 7,306 results for: GFP expression plasmids
-
Plasmid#136060PurposeG3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV GG hUbV-EGFP
Plasmid#216161PurposeContains a Golden-Gate cloning cassette to express up to four gRNA and EGFPDepositorTypeEmpty backboneUseLentiviralAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFAP-Archon-EGFP
Plasmid#187979PurposeExpresses the fluorescent voltage indicator Archon under the GFAP promoterDepositorInsertArchon1-EGFP
UseAAVAvailable SinceAug. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP726_L2_pV01_0I_TMV-tGFP_TCTP-fLUC
Plasmid#192406PurposeTo be a control plasmid that has no Rluc repression (replaced by turboGFP) and should reflect true off state of the circuit.DepositorInsertAct2::Turbo GFP
UseSynthetic BiologyTagsN7ExpressionPlantAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGFP-PTEN C124A
Plasmid#50520PurposeThis plasmid contains GFP21, which has a sequence similar to YFP, but emission/excitation similar to GFP.DepositorAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(2)
Plasmid#136061PurposeG3BP2 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GACAACTACTCCATCACTCA)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGFP-PTEN D92A
Plasmid#50521PurposeThis plasmid contains GFP21, which has a sequence similar to YFP, but emission/excitation similar to GFP.DepositorAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pACUH 5-HT2BR-7xGFP11-HA
Plasmid#221840PurposePlasmid for generating 10xUAS-5-HT2BR-7xGFP11-HA transgenic flies with attP/attB integration. It carries the attB sequence.DepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLei-sfGFP-D134*
Plasmid#191110PurposeAn E. coli sfGFP reporter with one TAG at position 134DepositorInsertsuperfolder green fluorescence protein
TagsHis tagExpressionBacterialMutationchanging D134 to TAGAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLei-sfGFP-V2*D134*
Plasmid#191111PurposeAn E. coli sfGFP reporter with two TAG at positions 2 & 134DepositorInsertsuperfolder green fluorescence protein
TagsHis tagExpressionBacterialMutationchanging V2 & D134 to TAGAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUt-MONARCH 1.0_crEGFP
Plasmid#224790PurposeLPUtopia matching RMCE donor plasmid with MONARCH 1.0 circuit with crRNA targeting EGFP. Use BlastR for positive and HSV-TK for negative selectionDepositorInsertcrEGFP
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterCMV-d2iAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-TadCBEd-SpCas9-P2A-EGFP (BKS327)
Plasmid#223123PurposepCMV and pT7 Human expression plasmid for TadCBEd-SpCas9 with C-term BPNLS-P2A-EGFPDepositorInserthuman codon optimized TadCBEd-SpCas9-2xUGI-P2A-EGFP
UseCRISPRTags2xUGI-BPNLS-P2A-EGFP and BPNLS-TadA-CDdExpressionMammalianMutationTadA-CDd mutations; nSpCas9=D10APromoterCMV and T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-SpCas9(KRHWMR)-P2A-EGFP_(RAS3808)
Plasmid#228251PurposepCMV human expression plasmid for SpCas9 enzyme with KRHWMR amino acids at positions 1135,1136,1218,1219,1335,T1337 with C-term BPNLS-P2A-EGFPDepositorInserthuman codon optimized nuclease SpCas9(KRHWMR)-P2A-EGFP
TagsBPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationSpCas9(ARGIMR)=D1135K, S1136R, G1218H, E1219W, R1…PromoterCMV and T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
rAAV-syn::FLEX-rev::PSAML141F,Y115F:5HT3HC-IRES-GFP
Plasmid#32477PurposeCre-dependent expression of PSAM-5HT3 HC (L141F,Y115F) neuronal activator, with IRES-EGFP markerDepositorInsertPSAML141F,Y115F-5HT3HC
UseAAV and Cre/Lox; Adeno-associated virus, flex swi…TagsIRES-EGFPPromoterSynapsinAvailable SinceJan. 12, 2012AvailabilityAcademic Institutions and Nonprofits only -
rAAV-syn::FLEX-rev::PSAMQ79G,Q139G:5HT3HC-IRES-GFP
Plasmid#32475PurposeCre-dependent expression of PSAM-5HT3 HC (Q79G,Q139G) neuronal activator, with IRES-EGFP markerDepositorInsertPSAMQ79G,Q139G-5HT3HC
UseAAV and Cre/Lox; Adeno-associated virus, flex swi…TagsIRES-EGFPPromoterSynapsinAvailable SinceDec. 12, 2011AvailabilityAcademic Institutions and Nonprofits only -
pALS2-sfGFP WT
Plasmid#197575PurposeFluorescence control plasmid for selecting ncAA-encoding Methanomethylophilus alvus Pyl-RS mutants. Expresses sfGFP-WT and M. alvus Pyl-tRNA(6). p15a origin of replicationDepositorInsertssfGFP WT
M. alvus Pyl-tRNA (6)
TagsHis6ExpressionBacterialPromoteraraC and lppAvailable SinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
ST-2xTstem(5A)-GFP
Plasmid#162504PurposeExpresses a ST6GAL1 mutant with a GFP tag in its C-terminus in mammalian cells. One wildtype Tac stem region is inserted within ST and the other mutated Tac stem region is inserted between ST and GFP.DepositorTagsGFPExpressionMammalianMutationOne Tac stem region is inserted within ST6Gal1 an…Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
ST-2xTstem-GFP
Plasmid#162503PurposeExpresses a ST6GAL1 mutant with a GFP tag in its C-terminus in mammalian cells. One Tac stem region is inserted within ST and the other Tac stem region is inserted between ST and GFP.DepositorTagsGFPExpressionMammalianMutationOne Tac stem region is inserted within ST6Gal1 an…Available SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
eGFP-PRM-3R
Plasmid#112156PurposeMammalian eGFP expression plasmid for PRM-3R.DepositorInsertPRM-3R (ABL1 Human)
ExpressionMammalianMutationcontains only the PRM domain of ABl1PromoterCMVAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Puro cTnT CCND2-T2A-ChloC-P2A-eGFP
Plasmid#179840Purposedonor plasmid for cardiac-specific CCND2-T2A-Chloc-P2A-eGFP expression in human cellsDepositorInsertCCND2 (CCND2 Human)
UseCRISPR and TALEN; Donor plasmidTagschloride-conducting ChR (ChloC) and eGFPExpressionMammalianPromoterTroponin T promoterAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only