We narrowed to 17,478 results for: igh
-
Plasmid#135820PurposeExpression of Leishmania donovani ectodomain in mammalian cellsDepositorInsertheat shock protein 90, putative,lipophosphoglycan biosynthetic protein, putative,glucose regulated p...
Tagsbiotinylation sequence and His tagExpressionMammalianAvailable SinceMarch 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
D2_Ld_030320
Plasmid#135818PurposeExpression of Leishmania donovani ectodomain in mammalian cellsDepositorInsertDDRGK domain containing protein, putative
Tagsbiotinylation sequence and His tagExpressionMammalianAvailable SinceMarch 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
D14_Ld_051070
Plasmid#135830PurposeExpression of Leishmania donovani ectodomain in mammalian cellsDepositorInsertLegume-like lectin family, putative
Tagsbiotinylation sequence and His tagExpressionMammalianAvailable SinceMarch 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
PRR4-bio-His
Plasmid#52075PurposeExpresses full-length Proline-rich protein 4 precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertPRR4 (PRR4 Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
TM9-bio-His
Plasmid#51831PurposeExpresses full-length Transmembrane 9 superfamily member 4 precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertTM9 (TM9SF4 Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
G6B-bio-His
Plasmid#51644PurposeExpresses full-length Protein G6b precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertG6B (MPIG6B Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
OVC Extended Collection
Plasmid Kit#1000000165PurposeFour plasmids containing the cloning cassette, eight plasmids containing LSDs engineered to heterodimerize and their binding partners, and five plasmids with different light-activated Opto-caspase 9.DepositorAvailable SinceOct. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-FLEX-jGCaMP7b-WPRE (AAV1)
Viral Prep#104493-AAV1PurposeReady-to-use AAV1 particles produced from pGP-AAV-syn-FLEX-jGCaMP7b-WPRE (#104493). In addition to the viral particles, you will also receive purified pGP-AAV-syn-FLEX-jGCaMP7b-WPRE plasmid DNA. Synapsin-driven, Cre-dependent jGCaMP7b expression. jGCaMP7b exhibits the brightest resting fluorescence and can be used for imaging of small neuronal processes (dendrites and axons). These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-jGCaMP7b-WPRE (AAV Retrograde)
Viral Prep#104489-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pGP-AAV-syn-jGCaMP7b-WPRE (#104489). In addition to the viral particles, you will also receive purified pGP-AAV-syn-jGCaMP7b-WPRE plasmid DNA. Syn-driven jGCaMP7b calcium sensor. jGCaMP7b exhibits the brightest resting fluorescence of the jGCaMP7 variants and can be used for imaging of small neuronal processes. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceNov. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pscAAV-CAG-GFP
Plasmid#83279Purposerecombinant AAV vector packaging self-complementary GFP under the CAG promoterDepositorInsertenhanced green fluorescent protein
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
B-HiFi SpCas9
Plasmid#207362PurposeExpression plasmid for human codon-optimized increased-fidelity (i.e. high-fidelity) SpCas9 variantDepositorInsertB-HiFi SpCas9
UseCRISPRTags3xFLAGExpressionMammalianMutationR691A, amino acids 1005-1013 replaced with two gl…PromoterCBhAvailable SinceOct. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDsRed-attP
Plasmid#51019PurposeVector for generating dsDNA donors for homology-directed repair to replace genes or other genomic sequence with an attP docking site. Contains the visible marker 3xP3-DsRed. As known as pHD-DsRed-attPDepositorInsertsattP
LoxP-3xP3-DsRed-LoxP
UseHigh copy, amp resistancePromoter3xP3 and NoneAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
Tn7 integration plasmid
Plasmid#154134PurposeSuicidal integration plasmid with the Tn7 arms, streptomycin and kanamycin resistance genes and the restriction site to clone the barcode-carrying cassette.DepositorInsertsleft and right end of Tn7 arm
Spectinomycin resistant gene
ExpressionBacterialPromoterSpectinomycin resistance gene promoter and noAvailable SinceJuly 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMT-C34-H
Plasmid#223966PurposeAnti-MT-C34 heavy chain expression plasmid; to be used with the light chain plasmid, pMT-C34-L (Plasmid 223967), to make the antibody.DepositorInsertVariable domain of mouse anti-MT-C34 IgG1 heavy chain jointed to constant region of human IgG1 heavy chain
ExpressionMammalianPromoterCMVAvailable SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
PTGS1-bio-His
Plasmid#53414PurposeExpresses full-length Prostaglandin G/H synthase 1 precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertPTGS1 (PTGS1 Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-Cepheid1b-ST-WPRE
Plasmid#214967PurposeRed fluorescent, negative response-polarity voltage indicator under the control of synapsin promoter; soma-targeted; for brighter fluorescenceDepositorInsertCepheid1b-ST
UseAAVPromoterhuman SynapsinAvailable SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
PDIA3-bio-His
Plasmid#52070PurposeExpresses full-length Protein disulfide-isomerase A3 precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertPDIA3 (PDIA3 Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pORTMAGE-3
Plasmid#72678PurposeExpresses Lambda Red recombinases and a dominant negative MutL allele all controlled by temperature sensitve cI857 repressor for high precision and efficiency MAGE experiments. Kan resistance marker.DepositorInsertmutL E32K
TagsnoneExpressionBacterialMutationE32K mutation conferring dominant mutator phenoty…Available SinceFeb. 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-mRuby2
Plasmid#40260PurposeRFP with robust performance in protein fusions and useful as FRET acceptor for Clover in a FRET pair that offers bright fluorescence, dynamic range, and photostability while limiting emissions overlapDepositorHas ServiceCloning Grade DNAInsertmRuby2
TagsHis6 and XpressExpressionMammalianPromoterCMV IEAvailable SinceSept. 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only