We narrowed to 6,377 results for: cat.2
-
Plasmid#233739PurposeExpresses SARS-CoV-2 Nsp3 residues 746-1063 for the purification of an active PLpro protease. Following Sumo Protease cleavage no nonnative residues remain on the PLpro proteinDepositorAvailable SinceFeb. 4, 2026AvailabilityAcademic Institutions and Nonprofits only
-
pGTM_SUMO_PLpro_W106F_001
Plasmid#234491PurposeExpresses SARS-CoV-2 Nsp3 residues 746-1063 for the purification of PLpro protease with a W106F mutation to allow for 5-fluorotryptophan incorporation and 19F NMRDepositorAvailable SinceFeb. 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
Yeast Secrete and Detect
Plasmid Kit#1000000166PurposeAssembly of transcription units for protein secretion in the yeasts Saccharomyces cerevisiae and Pichia pastoris.DepositorApplicationCloning and Synthetic BiologyVector TypeYeast ExpressionCloning TypeGolden Gate (MoClo)Available SinceJan. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMT-Hrp48-ADARcd-E488Q-V5
Plasmid#139685PurposeExpresses the hyperactive form of the catalytic domain of the ADAR protein fused to HRP-48 for use in "TRIBE" assaysDepositorAvailable SinceMarch 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-26kb-DSF
Plasmid#227482Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 26kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-29kb-USF
Plasmid#227466Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 29kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-700bp-USF
Plasmid#227478Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 700bp Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF5-H4(A5,8,12,16)-HaloTag-FRT
Plasmid#247455PurposeExpresses wild-type H4(A5,8,12,16)-Halo under EF1 promoter and can be integrated into FRT siteDepositorInsertH4 (H4C1) (H4C1 Human)
TagsHaloTagExpressionMammalianMutationH4(A5,8,12,16) has four mutations in the N-termin…PromoterEF1αAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF5-H4(Q5,8,12,16)-HaloTag-FRT
Plasmid#247454PurposeExpresses wild-type H4(Q5,8,12,16)-Halo under EF1 promoter and can be integrated into FRT siteDepositorInsertH4 (H4C1) (H4C1 Human)
TagsHaloTagExpressionMammalianMutationH4(Q5,8,12,16) has four mutations in the N-termin…PromoterEF1αAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF5-H4Δ1-19-HaloTag-FRT
Plasmid#247456PurposeExpresses wild-type H4(Δ1-19)-Halo under EF1 promoter and can be integrated into FRT siteDepositorInsertH4 (H4C1) (H4C1 Human)
TagsHaloTagExpressionMammalianMutationH4Δ1-19 lacks the initial 19 residues at the N-te…PromoterEF1αAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF5-H4(R5,8,12,16)-HaloTag-FRT
Plasmid#247453PurposeExpresses wild-type H4(R5,8,12,16)-Halo under EF1 promoter and can be integrated into FRT siteDepositorInsertH4 (H4C1) (H4C1 Human)
TagsHaloTagExpressionMammalianMutationH4(R5,8,12,16) has four mutations in the N-termin…PromoterEF1αAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP773_pLenti-6xHRBKET-sgRNA
Plasmid#211766PurposeMultiplexed gRNA plasmid targeting six different gene promoters (PACC1-2, EPCAM-2, B2M-4, KL-3, RBM3-1, HINT1-1), with mCherry selectionDepositorInsertgRNAs against six different human gene promoters (PACC1-2, EPCAM-2, B2M-4, KL-3, RBM3-1, HINT1-1)
UseLentiviralPromoterpCMV and U6Available SinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKT-CNP
Plasmid#211803PurposeExpresses 2',3'-cyclic nucleotide phosphodiesterase catalytic domainDepositorInsert2',3'-cyclic nucleotide phosphodiesterase catalytic domain (Cnp Rat)
ExpressionBacterialPromotertetAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJS699
Plasmid#168779PurposeEncodes the SARS-CoV-2 Spike Receptor Binding Domain (RBD) and can be combined with pJS697 through homologous recombinationDepositorAvailable SinceAug. 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformD
Plasmid#221824PurposePlasmid to express gRNA2 (ctgaagacataattacgtgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGTM_Sumo2-C-8XHis-PLpro
Plasmid#234321PurposeExpresses SARS-CoV-2 Nsp3 residues 746-1063 for the purification of an active PLpro protease. Following Sumo Protease Cleavage an 8xHis Tag is retained at the C-terminusDepositorInsertPLpro (ORF1ab SARS-CoV-2)
Tags6xHis-Sumo and 8xHisExpressionBacterialMutationnonePromoterT7 lacAvailable SinceFeb. 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGTM_Sumo2-N-StrepII-PLpro
Plasmid#234322PurposeExpresses SARS-CoV-2 Nsp3 residues 746-1063 for the purification of an active PLpro protease. Following Sumo Protease Cleavage a Strep-tag II sequence is retained at the N-terminusDepositorInsertPLpro (ORF1ab SARS-CoV-2)
Tags6xHis-Sumo and Strep-tag IIExpressionBacterialPromoterT7 lacAvailable SinceFeb. 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGTM_Sumo_PLpro_C111A
Plasmid#234489PurposeExpresses SARS-CoV-2 Nsp3 residues 746-1063 for the purification of PLpro protease with a C111A active site mutation that abolishes protease activity. Following Sumo Protease cleavage no nonnative resDepositorAvailable SinceFeb. 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGTM_Sumo2-N-8XHis-Plpro
Plasmid#233803PurposeExpresses SARS-CoV-2 Nsp3 residues 746-1063 for the purification of an active PLpro protease. Following Sumo Protease Cleavage an 8xHis Tag is retained at the N-terminusDepositorAvailable SinceFeb. 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pJH23
Plasmid#159314PurposePunc-25 GFP::SYD-2DepositorAvailable SinceSept. 22, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits