We narrowed to 15,445 results for: grn
-
Plasmid#80191Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available sinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - Amplicon, BCR/ABL sgRNA 2
Plasmid#70658PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an intergenic BCR/ABL-targeting sgRNA element from U6 promoter. Lentiviral backbone.DepositorPublicationInsertsgRNA against BCR/ABLamplicon found in CML-derived K562 cell line
UseCRISPR and LentiviralExpressionMammalianAvailable sinceMarch 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR U6 stuffer sgRNA scaffold L5-L2
Plasmid#62130PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a U6 promoter and sgRNA scaffold module for gRNA expression. Compatible with MultiSite Gateway cloningDepositorTypeEmpty backboneUseCRISPR and Gateway CloningExpressionMammalianAvailable sinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
Lenti-RNF2-tevopreQ1-epegRNA+5G>T_EF1a-puroR
Plasmid#207355PurposeLentiviral transfer plasmid encoding hU6-driven expression of a RNF2 engineered prime editing guide (epegRNA) and EF1a-driven puromycin resistance gene.DepositorInsertRNF2 + 5G>T tevopreq1-prime editing guide RNA (epegRNA)
UseLentiviralAvailable sinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-dCas9-KRAB-gRNA-TRE-blast
Plasmid#201152PurposeLentiviral expression of S. pyogenes dead Cas9 (dCas9/dSpCas9/SpdCas9) fused to the KRAB domain as well as a gRNA targeting the tight TRE promoter and the blasticidin resistance gene.DepositorInsertsdCas9-KRAB
gRNA-TRE
UseCRISPR and LentiviralTagsHAMutationgRNA sequence: TACGTTCTCTATCACTGATAvailable sinceJuly 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL3-U6-sgRNA-PGK- mRFP-T2A-PuroR
Plasmid#194925PurposemRFP and T2A linker are inserted in between the hPGK promoter and the puromycin resistance gene (PuroR) on pGL3-U6-sgRNA-PGK-puromycin to allow simultaneous monitoring and enrichment of transfected hoDepositorTypeEmpty backboneUseCRISPRPromoterhPGKAvailable sinceMay 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
BC1441-mouse U6-3xsgRNAs (TS5, TS6, TS7)
Plasmid#164040PurposeExpression of three sgRNAs (sgTS5, sgTS6, sgTS7) for targeting to CRISPR-Tag_V2DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgTS5-sgTS6-sgTS7
UseCRISPRPromotermouse U6Available sinceJan. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
1782_pAAV-U6-Ai9-Sa-gRNA2-CB-SACas9-HA-OLLAS-spA_C
Plasmid#135978PurposegRNA against the right loxP site of the Ai9 alleleDepositorInsertAi9 gRNA2
UseAAV, CRISPR, and Mouse TargetingTagsHAPromoterCBAvailable sinceJan. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-U6-SpyCas9-TLR-MCV1-sgRNA1
Plasmid#117405PurposeSpyCas9 sgRNA 1 targeting TLR2.0DepositorInsertSpyCas9 sgRNA targeting TLR 2.0
UseLentiviralExpressionMammalianPromoterU6Available sinceDec. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEG302 22aa SunTag NtDRMcd gRNA4 (FWA)
Plasmid#115486PurposeCRISPR-Cas9 SunTag system to target NtDRMcd to the FWA locus with a single guide RNADepositorInsertg4_U6_NOS_NLS_GB1_NLS_linker_DRMcd_linker_sfGFP_scFv_UBQ10_Insulator_UBQ10_Ω_dCas9_1xHA_3xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable sinceApril 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
hCRISPRi_dual_1_2
Pooled library#187246PurposeUltra-compact, human genome-wide CRISPRi library targeting each gene with a single element encoding a dual sgRNA cassette.DepositorSpeciesSyntheticUseLentiviralAvailable sinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Human Brunello kinome pooled library, guides 1-4 in lentiCRISPRv2 backbone
Pooled library#75314PurposeHuman sgRNA library in backbone lentiCRISPRv2 targeting 763 kinase genes and containing 3,052 unique sgRNAs along with 100 non-targeting controlsDepositorExpressionMammalianUseCRISPR and LentiviralAvailable sinceJune 27, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLenti-U6-epegRNA-SV40-mCherry
Plasmid#240538PurposeLentiviral backbone plasmid to insert epegRNAs (tevopreq1) of interest with mCherry. The cloning site is BsmBI.DepositorInsertepegRNA
UseCRISPR and LentiviralExpressionMammalianAvailable sinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgRNA-EF1a-LibVec
Plasmid#239591PurposeAAV vector for cloning and expression of sgRNAs - concomitant expression of GFP serves as transfection markerDepositorTypeEmpty backboneUseAAVExpressionMammalianPromoterhU6Available sinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLQ3538 eforRed-targeting sgRNA
Plasmid#239455Purposeguide for eforRedDepositorInsertguide targeting eforRed
UseCRISPR; Cell-free system using bacterial extractExpressionBacterialPromoterJ23119Available sinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT4-U6-sgRNA-CMV-EGFP
Plasmid#239587PurposeSleeping-beauty based EV for cloning and expression of sgRNAs - concomitant expression of GFP serves as transfection markerDepositorTypeEmpty backboneUseSleeping beauty transposoneExpressionMammalianPromoterhU6Available sinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs N-terminal sgRNA
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertAGCGGGACTCGGCGGCATGG
ExpressionMammalianPromoterCMV and U6Available sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR v2 puro mGSDME gRNA2
Plasmid#223522PurposeKnocking out mGSDME in mouse cellsDepositorAvailable sinceJan. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR v2 puro mGSDME gRNA1
Plasmid#223521PurposeKnocking out mGSDME in mouse cellsDepositorAvailable sinceJan. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pM148: pAAV.CMV-Cas13e-NT sgRNA
Plasmid#203446PurposePlasmid expressing active RfxCas13d with non-targeting gRNADepositorInsertsU6-non targeting (NT) sgRNA
Cas13e
UseAAVTagsHA and NLSExpressionMammalianPromoterCMV and U6Available sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only