We narrowed to 377 results for: 4290
-
Plasmid#229795PurposeBxb1-GT donor plasmid with downstream tandem syntax for all-in-one doxycycline-inducible expression of mouse neurogenin 2DepositorInsertTRE-mNgn2; rtTA-T2A-mTagBFP2 (Neurog2 Mouse)
UseSynthetic BiologyTagsNLSExpressionMammalianPromoterTRE and CAGAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
TFORF0979
Plasmid#141776PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0980
Plasmid#141777PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF3464
Plasmid#144940PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMT2-HA-RAPGEF2(S1244A/S1248A)
Plasmid#110163PurposeExpression of human RAPGEF2 (S1244A/S1248A) in mammalian cellsDepositorInsertRAPGEF2 (Rap guanine nucleotide exchange factor 2 (RAPGEF2 Human)
TagsHAExpressionMammalianMutationS1244A/S1248APromoterCMVAvailable SinceJune 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
MSCV-mouse Gfi1-IRES-GFP
Plasmid#91891PurposeRetroviral expression of mouse Gfi1DepositorAvailable SinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
TFORF2496
Plasmid#142114PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-331-3p
Plasmid#103444PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-331-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-331-3p target (MIR331 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pT2K-CAGGS-mouse Gfi1-IRES-GFP
Plasmid#91893PurposeMammalian expression of mouse Gfi1DepositorAvailable SinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPB CAG Gfi1:FLAG-IRES-EGFP
Plasmid#153945PurposepiggyBac transposon vector with CAG promoter expressing FLAG-tagged Gfi1 and EGFPDepositorAvailable SinceJuly 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
TFORF0347
Plasmid#143398PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceApril 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-335-3p
Plasmid#103446PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-335-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-335-3p target (MIR331 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-339-3p
Plasmid#103452PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-339-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-339-3p target (MIR338 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-340-5p
Plasmid#103459PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-340-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-340-5p target (MIR340 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGAL4-DBD-NGN2-AroLITE_A
Plasmid#215608PurposeFor overexpression of Gal4-DBD NGN2 AroLITEDepositorInsertNGN2 AroLITE (NEUROG2 Human)
ExpressionMammalianAvailable SinceMay 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGAL4-DBD-NGN2-AroPERFECT
Plasmid#215609PurposeFor overexpression of Gal4-DBD NGN2 AroPERFECTDepositorInsertNGN2 AroPERFECT (NEUROG2 Human)
ExpressionMammalianAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPB-TetON-mEGFP-NGN2_AroLITE_A
Plasmid#215611PurposeFor integration of NGN2 AroLITE T2A mEGFPDepositorAvailable SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPB-TetON-mEGFP-NGN2_AroPERFECT
Plasmid#215612PurposeFor integration of NGN2 AroLITE T2A mEGFPDepositorAvailable SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-ZNF404
Plasmid#88492PurposeDonor Vector containing ZNF404 transcription factor, part of the Human TFome CollectionDepositorInsertZNF404 (ZNF404 Human)
UseGateway donor vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only