We narrowed to 751 results for: gcg.2
-
Plasmid#183138PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii sxl, and 3 gRNA targeting D.suzukii bTub,Hr5Ie1-eGFP tagged, and can be integrated with pBac.DepositorInsertU6.3-gRNAs[sxl, bTub]
UseCRISPRExpressionInsectAvailable SinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
1056K
Plasmid#183137PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii sxl, and 1 gRNA targeting D.suzukii bTub,Opie-mVenus tagged, and can be integrated with pBac.DepositorInsertU6.3-gRNAs[sxl, bTub]
UseCRISPRExpressionInsectAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUDP044
Plasmid#101168PurposepUDP004 expressing a polycistronic g-RNA array for Cas9 editing targeting the genes SeATF1 and SeATF2 and Spcas9D147Y P411T in S. pastorianus (HH-gRNASeATF1-HDV-linker-HH-gRNASeATF2-HDV)DepositorInsertpolycistronic HH-gRNA-HDV-HH-gRNA-HDV array targetting SeATF1 and 2 in S. pastorianus
UseCRISPRExpressionYeastPromoterScTDH3Available SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCas9–mKate2ps–T1gRNA
Plasmid#62717Purposet1 gRNA (ATGAGAATCAAGGCGGTCGA)DepositorInsertCas9–mKate2ps
ExpressionMammalianAvailable SinceMay 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX330A-Yap1-E1-#1
Plasmid#171517Purposedeletion of a genomic locus in Yap1 geneDepositorAvailable SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMM117
Plasmid#127212PurposeBeYDV replicon with constitutive Luc expression, sgRNA targeting PDSDepositorInsertLuc, sgRNA
ExpressionPlantMutationcodon optimized CDSsAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCas9–mKate2ps–T1gRNA
Plasmid#62717Purposet1 gRNA (ATGAGAATCAAGGCGGTCGA)DepositorInsertCas9–mKate2ps
ExpressionMammalianAvailable SinceMay 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSB1C3-hsg(M)
Plasmid#138262PurposeSubcloning and expression of mCherry-targeting sgRNA M for use in Traffic Light reporter systemDepositorInsertsgRNA M
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEh_gRNA1
Plasmid#178758PurposeExpression of a gRNA that targets next to PAM library, used for E. haloalkaliphila type I-E systemDepositorInsertgRNA that targets next to PAM library, used for E. haloalkaliphila type I-E system
ExpressionBacterialAvailable SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMs_gRNA1
Plasmid#178764PurposeExpression of a gRNA that targets next to PAM library, used for Marinomonas sp. type I-E systemDepositorInsertgRNA that targets next to PAM library, used for Marinomonas sp. type I-E system
ExpressionBacterialAvailable SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLm_gRNA1
Plasmid#178752PurposeExpression of a gRNA that targets next to PAM library, used for L. mobilis type I-E systemDepositorInserta gRNA that targets next to PAM library, used for L. mobilis type I-E system
ExpressionBacterialAvailable SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
Ssh3 gRNA#3
Plasmid#163402PurposeCas9-mediated knockout of Ssh3 in mammalian cellsDepositorAvailable SinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
ptreCas9-mKate2ps-T1gRNA
Plasmid#62715PurposeInducible; gRNA seq is ATGAGAATCAAGGCGGTCGADepositorInsertCas9–mKate2ps
ExpressionMammalianAvailable SinceMay 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMM134
Plasmid#127215PurposeBeYDV replicon with constitutive Luc expression, IPT, sgRNA targeting PDSDepositorInsertLuc, IPT, sgRNA
ExpressionPlantMutationcodon optimized CDSsAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMM119
Plasmid#127213PurposeBeYDV replicon with constitutive GFP expression, WUS2, sgRNA targeting PDSDepositorInsertGFP, WUS2, sgRNA
ExpressionPlantMutationcodon optimized CDSsAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMM146
Plasmid#127218PurposeBeYDV replicon with constitutive Luc expression, BBM, sgRNA targeting PDSDepositorInsertLuc, BBM, sgRNA
ExpressionPlantMutationcodon optimized CDSsAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMM136
Plasmid#127217PurposeBeYDV replicon with constitutive Luc expression, MP-delta, sgRNA targeting PDSDepositorInsertLuc, MP-delta, sgRNA
ExpressionPlantMutationcodon optimized CDSsAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMM135
Plasmid#127216PurposeBeYDV replicon with constitutive Luc expression, WUS2, sgRNA targeting PDSDepositorInsertLuc, WUS2, sgRNA
ExpressionPlantMutationcodon optimized CDSsAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMM131
Plasmid#127214PurposeBeYDV replicon with constitutive Luc expression, AtSTM, sgRNA targeting PDSDepositorInsertLuc, AtSTM, sgRNA
ExpressionPlantMutationcodon optimized CDSsAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCFD3-frame_selector_2
Plasmid#127555PurposeDrosophila expression of frame selector sgRNA 2 that targets CRISPaint site for homology-independent knock-inDepositorInsertsgRNA frame 2
UseCRISPRExpressionInsectPromoterdU6:3Available SinceJuly 16, 2019AvailabilityAcademic Institutions and Nonprofits only