...TAL3240 & TAL3241 TGGTGGCGCAGCAGAGGGagctgatccaggaccaGGCCACCGTGAACATCA DLK1 (site #2) TAL3422 & TAL3423...hemogen (site #2) TAL3276 & TAL3277 TGATTTGTTTGTTTGCTaggaggaattcggcggCGACTCAGAGACAGAGA her6 TAL3094 & ... 3012 & TAL 3013 TGGAGCAGGGTGCGAGTGtgtctgagctgaaggaGGCGGTGGGTCGTTTACA park2 (site #2) TAL3334 & TAL3335...pigmentosa 2 (X-linked recessive) TAL3526 & TAL3527 TCTTTTTGTGCTGCGCCAcccagcccataatcgaGTCTTCTACAGGCATGAA retinitis...TAL3178 & TAL3179 TGGAAACCGAGCTGAAGCccccggcgccccagcccaACACCGGGGGCACGGGGA Sox2 (site #2) TAL3368 & TAL3369...TGTTTCAGCAGAGCCCCGctgaagagctccccatGGAGATGGAAGGAGTGGA hif1al (site #2) TAL3280 & TAL3281 TGCCCTCAGGACTTCTGCacgcctgaactccgcaAGCTTCTGTCTCCAATA...abcg2a TAL3400 & TAL3401 TGTCCTCATCCCCGTCCCgccgcggcgccaccgtCAGCTTCCACAACATCAA adam15 TAL3016 & TAL3017...

...BioBrick-2 BglBrick Silver Standard Freiburg Standard BioBrick (RFC 10) Prefix: GAATTC GCGGCCGC T TCTAGA... (RFC 10) Back to Top BioBrick BB-2 (RFC 12) Prefix: GAATTC GCGGCCGC T ACTAGT G Prefix Enzymes: EcoR1 ...XbaI, SapI For more info, visit iGEM: BioBrick BB-2 (RFC 12) Back to Top BglBrick – Berkeley Standard ...Prefix: GAATTC GCGGCCGC T TCTAGA G Prefix Enzymes: EcoR1 , NotI , XbaI Suffix: T ACTAGT A GCGGCCG CTGCAG Suffix... 25) Prefix: GAATTC GCGGCCGC T TCTAGA TG GCCGGC Alternate Prefix: GAATTC GCGGCCGC T TCTAG (for "N-parts...TCTAGA G Alternate Prefix: GAATTC GCGGCCGC T TCTAGA TG (contains start) Prefix Enzymes: EcoR1 , NotI , XbaI...XbaI Suffix: T ACTAGT A GCGGCCG CTGCAG Suffix Enzymes: SpeI , NotI , PstI Scar: TACTAGAG or TACTAG Features...

...23792628 Joung fbf-2 C. elegans GTAGTCACGGCGATGATTA 65597 cut S. pyogenes 25249454 Seydoux fbf-2 C. elegans TAATCATCGCCGTGACTAC...AMPK alpha 2 H. sapiens GTCAGCCATCTTCGGCGCGCG 74376 nick S. pyogenes 26816379 Shaw AMPK alpha 2 H. sapiens... & Lim swan-2 C. elegans ACAAATTGATATCCAATCA 66100 cut S. pyogenes 25249454 Seydoux swan-2 C. elegans ...Kit-1 R. norvegicus CATCTGTGCGGCCGTTGGCT 60969 cut S. pyogenes 24967838 Mashimo Kit-2 R. norvegicus CTAACGTTCCAGCGCTCGTT.... pyogenes Fungal Biology and Biotechnology 2015, 2:4 Hong Ctnnb1 M. musculus AGCTCCTTCCCTGAGTGGCA 59912...CTAACGTTCCAGCGCTCGTT 60970 cut S. pyogenes 24967838 Mashimo Kit-2 R. norvegicus GTCAAGATGTCATCTTACGG 60971 cut S. pyogenes...rerio GGAGCGAGCGGAGCGGTACA 42244 cut S. pyogenes 23360964 Joung fh D. rerio GGAGCGGTACATGGCGACCG 42243...

...corepressor 2 OZ553 and OZ554 OPEN OPEN gCTCACCATCtgttggaTGCGATGGAa cdkn1a (p21) OZ555 and OZ556 OPEN OPEN...modification. Maeder ML et al. Mol Cell. . 2008. Jul 25. 31(2):294-301. PubMed PMID 18657511 . Oligomerized pool...OPEN OPEN gCGTGACCTCgctgatAAGAAGAGg xylt1 OZ509 and OZ510 OPEN OPEN cACCCTCTACaggacaGTAGCGGGTg zgc:153086...OPEN OPEN gCGCCACGGAcaataaaGAGGACTGCa GUSB OZ551 and OZ552 OPEN OPEN gGTCATCTGCcattcGAGGCGGACa REST corepressor...CODA CODA gTCCAGCAGCGGTGAGGATGAAGACg unc119b OZ581 and OZ582 CODA CODA tTGCTGCCGCGGATGCTGTGGCGGTTa cx52.9...cTGCTACTTCtggatGGAGAAACGa pitx2 OZ533 and OZ534 OPEN OPEN cCGCTTCAGCggtctGTGGACTCGa zebrafish similar to grp151 (or gpcr-2037... or cav1.3b OZ547 and OZ548 OPEN OPEN gAGCTCCGTCtcgctgGCGGCCGAAg histamine receptor H3 (hrh3) OZ549 and...

...satisfactorily accepts DNA as its substrate (see figure 2).          The artificially evolved adenosine deaminase...editing platforms for plant systems.  Figure 2: Plant base editor platforms and their molecular components...available for plant systems. Target-AID based (CBE-2)-  and rAPOBEC based (CBE-1)-  CBEs are successful...based CBEs are known to deaminate cytosine placed in 2-6 bp and 4-8 bp, respectively, of the protospacer....PMID: 27096365. PubMed Central PMCID: PMC4873371.  2. Nishida, Keiji, et al. "Targeted nucleotide editing...KKH TadA-TadA* NNNRRT 8 SpCas9-VRER TadA-TadA* NGCG 8  Tips for designing base editing experiments...

...is unique compared to the rest of the genome and (2) the sequence is located just upstream of a Protospacer...pyogenes Cas9 variants with varying PAM sequences, 2) the use of Cas9 homologs derived from species other...Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell 163:759–771 . https://doi....VRER variant D1135V, G1218R, R1335E and T1337R NGCG The D1135E variant is far more selective for...

...NGG)  Editing window ~2 nt  85176  pBK-YE2-BE3  SpCas9 (NGG)  Editing window ~2 nt  85177  pBK-YEE-...pBK-VRER-BE3  VRER-Cas9 (NGCG)    85174  pBK-YE1-BE3  SpCas9 (NGG)  Editing window ~2 nt  85175  pBK-EE-BE3...quantum yield of 0.54) and mScarlet-H with M164H (2-fold improvement in photostability compared to mScarlet...SpCas9 base editors with editing windows as small as 1-2 nucleotides! To reduce off-target effects associated...Lower on-target activity than BE3; editing window ~1-2 nt  87438  pET42b-HF-BE3  HF-Cas9 (NGG)  Very low...Ladders Are Awesome Tools: They are comprised of 2 plasmids, pPSU1 and pPSU2, that can be amplified affordably...libraries The Gross Lab at UCSF recently deposited 2 Bacillus subtilis libraries with Addgene – the B. ...

...immunoglobulin heavy diversity 2-15 D2, IGHD215 IGHD2-2 immunoglobulin heavy diversity 2-2 IGHD22 IGHD2-21 immunoglobulin...heat shock 70kDa protein 2 HSP70-2, HSP70-3 HSPA4 heat shock 70kDa protein 4 APG-2, HS24/P52, MGC131852, ...variable 2-33 (non-functional) IGLV233, V1-9 IGLV2-8 immunoglobulin lambda variable 2-8 IGLV28, V1-2 IGLV3...beta 4 DEFB-2, DEFB102, DEFB2, HBD-2, SAP1 EDN1 endothelin 1 ET1, HDLCQ7 EDN2 endothelin 2 ET2, PPET2 ...receptor subfamily 2, group C, member 1 TR2 NR2C2 nuclear receptor subfamily 2, group C, member 2 TAK1, TR2R1...suppression of tumorigenicity 2 - STC1 stanniocalcin 1 STC STC2 stanniocalcin 2 STC-2, STCRP TAC1 tachykinin,...galanin receptor 2 GALNR2, MGC125983, MGC125984 GALR3 galanin receptor 3 - GAST gastrin GAS GCG glucagon GLP1...

...Without binding to the guide RNA, Cas9 cannot cut. 2. Bind to target DNA in the presence of a guide RNA...reduced NAG binding) SpCas9 VRER variant 3' NGCG SpCas9 EQR variant 3' NGAG SpCas9 VQR ...

...divided by the off-target activity. Figure 2: Specificity is the measure of off-target activity... different PAM sites (NGG, NGAN, NGNG, NGAG, and NGCG). Since then, the Osamu Nureki Lab described a rationally...

...) 12 (>100) xCas9(3.7)-ABE 69 (1.4) 43 (2) 21 (3) Not examined 16 (>100) Average percent...SpCas9 variants with alternative PAMs like NGAG and NGCG and SaCas9 with an NNGRRN PAM by mutagenizing the...

...left free to interact with the target DNA. Figure 2: Overview of the NHEJ repair mechanism Cas9 will only...systems enable researchers to target anywhere from 2–7 genetic loci by cloning multiple gRNAs into a single...Cas9 is included in the gRNA-containing plasmid, or 2-vector systems, in which Cas9 must be delivered separately...your experimental cell population (Figure 8E). In a 2-vector system, you’ll need to either co-infect with...the presence of infectious organisms (like SARS-CoV-2 ) and genetic mutations. Similar to Cas9 and Cas12...Cas enzymes? CasPEDIA is an encyclopedia of Class 2 CRISPR systems with wiki entries describing enzyme...off-target effects by using a single Cas9 nickase and 2 different gRNAs, which bind in close proximity on ...

...Letter Code Codons (RNA) Alanine Ala A GCU, GCC, GCA, GCG Arginine Arg R CGU, CGC, CGA, CGG, AGA, AGG Asparagine...indicated, the antibiotic powder can be dissolved in dH 2 0. Addgene recommends making 1000X stock solutions...

...left free to interact with the target DNA. Figure 2: Overview of the NHEJ repair mechanism Cas9 will only...systems enable researchers to target anywhere from 2–7 genetic loci by cloning multiple gRNAs into a single...Cas9 is included in the gRNA-containing plasmid, or 2-vector systems, in which Cas9 must be delivered separately...your experimental cell population (Figure 8E). In a 2-vector system, you’ll need to either co-infect with...the presence of infectious organisms (like SARS-CoV-2 ) and genetic mutations. Similar to Cas9 and Cas12...Cas enzymes? CasPEDIA is an encyclopedia of Class 2 CRISPR systems with wiki entries describing enzyme...off-target effects by using a single Cas9 nickase and 2 different gRNAs, which bind in close proximity on ...

...cooling to room temperature (~45 minutes). Method #2 Place mixed oligos in a PCR tube. Place tube in a ...a thermocycler programmed to start at 95°C for 2 minutes. Then, gradually cool to 25°C over 45 minutes...vector with 0.75-6 ng of annealed oligos). Transform 2-3μL into your favorite competent bacteria and plate...CATATG TTAATTAA GGCGCGCC CAATTG - 3' = 28 bp Bottom oligo: 3' - GTATAC AATTAATT CCGCGCGG GTTAAC - 5' = ... CATATG TTAATTAA GGCGCGCC CAATTG G - 3' Bottom oligo: 3' - G GTATAC AATTAATT CCGCGCGG GTTAAC CAGCT - 5...' - AATTCCATATGTTAATTAAGGCGCGCCCAATTGG - 3' Bottom oligo: 5' - TCGACCAATTGGGCGCGCCTTAATTAACATATGG - 3'...tandem ( NdeI - CATATG , PacI - TTAATTAA , AscI - GGCGCGCC , MfeI - CAATTG ). The bottom oligo will be the...

... 95 10 2 1 Denaturation 95 0.5 2 50 Annealing/Extension 60 1 2 50 Signal Stabilization 98 10 2 1 Hold ...should decrease by a factor of 2 across the dilutions. In the example below, 2-fold serial dilutions of a ... considered biosafety level 1 but may require BSL-2 handling depending on the insert. Please ensure that...single channel pipette 1–10 µL multichannel pipette 2–50 µL multichannel pipette 20–200 µL multichannel ...20X): 5 µL in 95 µL 1X PCR buffer (1:20) Dilution 2 (20X): 5 µL in 95 µL 1X PCR buffer (1:400) Dilution... DG8 cartridge into the cartridge holder. Using a 2–50 µL multichannel pipet, load 20 µL of the reaction...Hold 4 ∞ 2 1 After PCR is complete, transfer the plate to the Droplet Reader. Open the QuantaSoft software...

... 10 90 2 x 10 8 10 of 2 x 10 8 dilution 90 2 x 10 7 10 of 2 x 10 7 dilution 90 2 x 10 6 10 of 2 x 10 6...6 dilution 90 2 x 10 5 10 of 2 x 10 5 dilution 90 2 x 10 4 10 of 2 x 10 4 dilution 90 2 x 10 3 Pro-Tip...molecules/μL To obtain a solution at 2 x 10 9 molecules/μL: 1.59 x 10 11 / 2 x 10 9 = 79.8X dilution ...your standard curve plasmid (2 x 10 9 stock made in step #1): Volume of 2 x 10 9 stock or previous dilution...stock 45 uL 10X 10X Dilution 2 5 uL Dil. 1 95 uL 20X 200X Dilution 3 20 uL Dil. 2 80 uL 5X 1000X Dilution ...time required: ~3 h Workflow Timeline Plate set-up: 2 h qPCR run: 1.5 h Data analysis: 30 min Equipment ...single channel pipette 1–10 µL multichannel pipette 2–50 µL multichannel pipette 20–200 µL multichannel ...

...-24 bases 40-60% G/C content Start and end with 1-2 G/C pairs Melting temperature (Tm) of 50-60°C Primer...order for the enzyme to cleave efficiently (e.g. GCGGCG-restriction site-your sequence). Protocol Video...

...DNA concentration alone. One method is to conduct 2 ligations for each plasmid you are trying to create...'-TGGCATATCTCGAAGTACTGA-3'), then adding NotI (GCGGCCGC) and then TAAGCA to improve restriction enzyme.... This gives us a sequence of 5'-TGGCATATCTCGAAGTACTGAGCGGCCGCTAAGCA-3' (30bp with 18bp of homology to...chose for our reverse primer (5’-TGGCATATCTCGAAGTACTGAGCGGCCGCTAAGCA-3’) into this calculator we get a...final Reverse Primer sequence of 5’-TGCTTAGCGGCCGCTCAGTACTTCGAGATATGCCA-3’. Experimental Procedure Run PCR...