...cooling to room temperature (~45 minutes). Method 2. Place mixed oligos in a PCR tube. Place tube in a... a thermocycler programmed to start at 95°C for 2 minutes. Then, gradually cool to 25°C over 45 minutes...vector with 0.75-6 ng of annealed oligos). Transform 2-3μL into your favorite competent bacteria and plate...CATATG TTAATTAA GGCGCGCC CAATTG - 3' = 28 bp Bottom oligo: 3' - GTATAC AATTAATT CCGCGCGG GTTAAC - 5' = ... CATATG TTAATTAA GGCGCGCC CAATTG G - 3' Bottom oligo: 3' - G GTATAC AATTAATT CCGCGCGG GTTAAC CAGCT - 5...' - AATTCCATATGTTAATTAAGGCGCGCCCAATTGG - 3' Bottom oligo: 5' - TCGACCAATTGGGCGCGCCTTAATTAACATATGG - 3'...tandem ( NdeI - CATATG , PacI - TTAATTAA , AscI - GGCGCGCC , MfeI - CAATTG ). The bottom oligo will be the...

... 95 10 2 1 Denaturation 95 0.5 2 50 Annealing/Extension 60 1 2 50 Signal Stabilization 98 10 2 1 Hold ...should decrease by a factor of 2 across the dilutions. In the example below, 2-fold serial dilutions of a ... considered biosafety level 1 but may require BSL-2 handling depending on the insert. Please ensure that...single channel pipette 1–10 µL multichannel pipette 2–50 µL multichannel pipette 20–200 µL multichannel ...20X): 5 µL in 95 µL 1X PCR buffer (1:20) Dilution 2 (20X): 5 µL in 95 µL 1X PCR buffer (1:400) Dilution... DG8 cartridge into the cartridge holder. Using a 2–50 µL multichannel pipet, load 20 µL of the reaction...Hold 4 ∞ 2 1 After PCR is complete, transfer the plate to the Droplet Reader. Open the QuantaSoft software...

...-24 bases 40-60% G/C content Start and end with 1-2 G/C pairs Melting temperature (Tm) of 50-60°C Primer...order for the enzyme to cleave efficiently (e.g. GCGGCG-restriction site-your sequence). Protocol Video...

...stock 45 uL 10x 10x Dilution 2 5uL Dil. 1 95 uL 20x 200x Dilution 3 20uL Dil. 2 80 uL 5x 1000x Dilution 4... AAV preparation. Workflow Timeline Plate set-up: 2 hours qPCR run: 1.5 hours Data analysis: 30 minutes...Therefore we need to dilute 1.25 μL stock into 98.74 μL H 2 0 *Pro-Tips* Once a validated standard curve is obtained...a small aliquot of each standard (enough for 1 or 2 plates) and store at -20°C. Once a standard is thawed...does not penetrate the virion). 5μL sample + 39μL H 2 O + 5μL 10x DNase buffer + 1μL DNase Gently mix sample...with transparent film. Centrifuge at 3,000 rpm for 2 min to bring the sample to the bottom of the tube....from step 3 / melt curve Example of plate set-up: 1 2 3 4 5 6 7 8 A 1.00 x 10 9 1.00 x 10 8 1.00 x 10 7 ...

...DNA concentration alone. One method is to conduct 2 ligations for each plasmid you are trying to create...'-TGGCATATCTCGAAGTACTGA-3'), then adding NotI (GCGGCCGC) and then TAAGCA to improve restriction enzyme... This gives us a sequence of 5'-TGGCATATCTCGAAGTACTGAGCGGCCGCTAAGCA-3' (30bp with 18bp of homology to...chose for our reverse primer (5’-TGGCATATCTCGAAGTACTGAGCGGCCGCTAAGCA-3’) into this calculator we get a...final Reverse Primer sequence of 5’-TGCTTAGCGGCCGCTCAGTACTTCGAGATATGCCA-3’. Experimental Procedure Run PCR...