...cooling to room temperature (~45 minutes). Method #2 Place mixed oligos in a PCR tube. Place tube in a ...a thermocycler programmed to start at 95°C for 2 minutes. Then, gradually cool to 25°C over 45 minutes...vector with 0.75-6 ng of annealed oligos). Transform 2-3μL into your favorite competent bacteria and plate...CATATG TTAATTAA GGCGCGCC CAATTG - 3' = 28 bp Bottom oligo: 3' - GTATAC AATTAATT CCGCGCGG GTTAAC - 5' = ... CATATG TTAATTAA GGCGCGCC CAATTG G - 3' Bottom oligo: 3' - G GTATAC AATTAATT CCGCGCGG GTTAAC CAGCT - 5...' - AATTCCATATGTTAATTAAGGCGCGCCCAATTGG - 3' Bottom oligo: 5' - TCGACCAATTGGGCGCGCCTTAATTAACATATGG - 3'...tandem ( NdeI - CATATG , PacI - TTAATTAA , AscI - GGCGCGCC , MfeI - CAATTG ). The bottom oligo will be the...

... 95 10 2 1 Denaturation 95 0.5 2 50 Annealing/Extension 60 1 2 50 Signal Stabilization 98 10 2 1 Hold ...should decrease by a factor of 2 across the dilutions. In the example below, 2-fold serial dilutions of a ... considered biosafety level 1 but may require BSL-2 handling depending on the insert. Please ensure that...single channel pipette 1–10 µL multichannel pipette 2–50 µL multichannel pipette 20–200 µL multichannel ...20X): 5 µL in 95 µL 1X PCR buffer (1:20) Dilution 2 (20X): 5 µL in 95 µL 1X PCR buffer (1:400) Dilution... DG8 cartridge into the cartridge holder. Using a 2–50 µL multichannel pipet, load 20 µL of the reaction...Hold 4 ∞ 2 1 After PCR is complete, transfer the plate to the Droplet Reader. Open the QuantaSoft software...

... 10 90 2 x 10 8 10 of 2 x 10 8 dilution 90 2 x 10 7 10 of 2 x 10 7 dilution 90 2 x 10 6 10 of 2 x 10 6...6 dilution 90 2 x 10 5 10 of 2 x 10 5 dilution 90 2 x 10 4 10 of 2 x 10 4 dilution 90 2 x 10 3 Pro-Tip...molecules/μL To obtain a solution at 2 x 10 9 molecules/μL: 1.59 x 10 11 / 2 x 10 9 = 79.8X dilution ...your standard curve plasmid (2 x 10 9 stock made in step #1): Volume of 2 x 10 9 stock or previous dilution...stock 45 uL 10X 10X Dilution 2 5 uL Dil. 1 95 uL 20X 200X Dilution 3 20 uL Dil. 2 80 uL 5X 1000X Dilution ...time required: ~3 h Workflow Timeline Plate set-up: 2 h qPCR run: 1.5 h Data analysis: 30 min Equipment ...single channel pipette 1–10 µL multichannel pipette 2–50 µL multichannel pipette 20–200 µL multichannel ...

...-24 bases 40-60% G/C content Start and end with 1-2 G/C pairs Melting temperature (Tm) of 50-60°C Primer...order for the enzyme to cleave efficiently (e.g. GCGGCG-restriction site-your sequence). Protocol Video...

...DNA concentration alone. One method is to conduct 2 ligations for each plasmid you are trying to create...'-TGGCATATCTCGAAGTACTGA-3'), then adding NotI (GCGGCCGC) and then TAAGCA to improve restriction enzyme.... This gives us a sequence of 5'-TGGCATATCTCGAAGTACTGAGCGGCCGCTAAGCA-3' (30bp with 18bp of homology to...chose for our reverse primer (5’-TGGCATATCTCGAAGTACTGAGCGGCCGCTAAGCA-3’) into this calculator we get a...final Reverse Primer sequence of 5’-TGCTTAGCGGCCGCTCAGTACTTCGAGATATGCCA-3’. Experimental Procedure Run PCR...